deidra
Uploaded by
43 SLIDES
778 VUES
430LIKES

Nucleic Acid Chemistry

DESCRIPTION

Nucleic Acid Chemistry. Where the info is…interpreting the blueprint. Central Dogma. DNA ----------------  RNA-------------- protein. Replication. transcription. translation. Central Dogma. Replication DNA making a copy of itself Making a replica Transcription

1 / 43

Télécharger la présentation

Nucleic Acid Chemistry

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Nucleic Acid Chemistry Where the info is…interpreting the blueprint

  2. Central Dogma DNA ---------------- RNA-------------- protein Replication transcription translation

  3. Central Dogma • Replication • DNA making a copy of itself • Making a replica • Transcription • DNA being made into RNA • Still in nucleotide language • Translation • RNA being made into protein • Change to amino acid language

  4. Replication • Remember that DNA is self complementary • Replication is semiconservative • One strand goes to next generation • Other is new • Each strand is a template for the other • If one strand is 5’ AGCT 3’ • Other is: 3’ TCGA 5’

  5. Replica • Write the strand complementary to: 3’ ACTAGCCTAAGTCG 5’ Answer

  6. Replication is Semiconservative

  7. Replication • Roles of enzymes • Topoisomerases • Helicase • DNA polymerases • ligase • DNA binding proteins • DNA synthesis • Leading strand • Lagging strand

  8. Replication

  9. Replication • Helix opens • Helicase • Causes supercoiling upstream • Topoisomerases (gyrase) • DNA Binding Proteins • Prevent reannealing

  10. Replication

  11. Replication • Leading strand • 3’ end of template • As opens up, DNA polymerase binds • Makes new DNA 5’ - 3’ • Same direction as opening of helix • Made continuously

  12. Replication

  13. Replication • Lagging strand • 5’ end of template • Can’t be made continuously as direction is wrong • RNA primer • New DNA made 5’  3’ • Opposite direction of replication • Discontinuous • Okazaki fragments • Ligase closes gaps

  14. Transcription • DNA template made into RNA copy • Uracil instead of Thymine • One DNA strand is template • Sense strand • Other is just for replication • Antisense (not to be confused with nonsense!) • In nucleus • nucleoli

  15. Transcription • From following DNA strand, determine RNA sequence 3’ GCCTAAGCTCA 5’ Answer

  16. Transcription

  17. Transcription • DNA opens up • Enzymes? • RNA polymerase binds • Which strand? • Using DNA template, makes RNA • 5’-3’ • Raw transcript called hnRNA

  18. Transcription How does RNA polymerase know where to start? upstream promotor sequences Pribnow Box TATA box RNA polymerase starts transcription X nucleotides downstream of TATA box

  19. Introns and Exons • Introns • Intervening sequences • Not all DNA codes for protein • Regulatory info, “junk DNA” • Exons • Code for protein

  20. Processing of hnRNA into mRNA • 3 steps • Introns removed • Self splicing • 5’ methyl guanosine cap added • Poly A tail added • Moved to cytosol for translation

  21. Processing of hnRNA into mRNA

  22. Translation • RNA -- Protein • Change from nucleotide language to amino acid language • On ribosomes • Vectorial nature preserved • 5’ end of mRNA becomes amino terminus of protein • Translation depends on genetic code

  23. Genetic Code • Nucleotides read in triplet “codons” • 5’ - 3’ • Each codon translates to an amino acid • 64 possible codons • 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities • Degeneracy or redundancy of code • Only 20 amino acids • Implications for mutations

  24. Genetic Code

  25. Genetic Code • Not everything translated • AUG is start codon • Find the start codon • Also are stop codons • To determine aa sequence • Find start codon • Read in threes • Continue to stop codon

  26. Translation • Steps: • Find start codon (AUG) • After start codon, read codons, in threes • Use genetic code to translate Translate the following: GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Answer

  27. Translation Process • Requires Ribosomes, rRNA, tRNA and, of course, mRNA • Ribosome • Made of protein and rRNA • 2 subunits • Has internal sites for 2 transfer RNA molecules

  28. Ribosome Left is cartoon diagramRight is actual picture

  29. Transfer RNA • Mostly double stranded • Folds back on itself • Several loops • Anticodon loop • Has complementary nucleotides to codons • 3’ end where aa attach

  30. Transfer RNA

  31. Translation • Initiation • Ribosomal subunits assemble on mRNA • rRNA aids in binding of mRNA • Elongation • tRNAs with appropriate anticodon loops bind to complex • have aa attached (done by other enzymes) • Amino acids transfer form tRNA 2 to tRNA 1 • Process repeats • Termination • tRNA with stop codon binds into ribosome • No aa attached to tRNA • Complex falls apart

  32. Translation

  33. Translation • Happening of process (circa 1971) • http://www.youtube.com/watch?v=u9dhO0iCLww

  34. Mutations • Changes in nucleotide sequence • Can cause changes in aa sequence • Degeneracy in genetic code can prevent • Two types • Point mutations • Single nucleotide changes • Frame shift • Insertions or deletions

  35. Point Mutations • Single nucleotide changes • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUGGGU AGU GAG GCA ACC UGA ACC GAC aa: G S E A T

  36. Point mutations • Depending on change, may not change aa sequence • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUGGGU AGA GAG GCA ACC UGA ACC GAC aa: G R E A T

  37. Point Mutations • Change could make little difference • If valine changed to leucine, both nonpolar • Change could be huge, • Could erase start codon • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUU GGU AGA GAG GCA ACC UGA ACC GAC aa: no start codon…protein not made

  38. Point Mutations • Other possibilities, • Stop codon inserted • Truncated protein • Stop codon changed • Extra long protein • Bottom line, • Depends on what change is

  39. Frame Shift mutations • Insertions or deletions • Change the reading frame • Insertion example Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUGGGU AGG AGA GGC AAC CUG AAC CGA C aa: G R R G N L N R

  40. Frame Shift Mutations • Deletion example • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence Delete second A (Underlined above) AUGGGU GGG AGG CAA CCU GAA CCG AC aa: G G R Q P G P

  41. Complementary DNA Strand Template: 3’ ACTAGCCTAAGTCG 5’ 5’ TGATCGGATTCAGC 3’ Back

  42. RNA Transcript DNA 3’ GCCTAAGCTCA 5’ RNA 5’ CGGAUUCGAGU 3’ Back

  43. Translation Answer Find start codon GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Read in threes after that: AUG GGU AGG GAG GCA ACC UGA ACC GAC Using Genetic code AUG GGU AGG GAG GCA ACC UGA ACC GAC G R E A T stop After stop codon…rest is garbage Back

More Related