430 likes | 774 Vues
Nucleic Acid Chemistry. Where the info is…interpreting the blueprint. Central Dogma. DNA ---------------- RNA-------------- protein. Replication. transcription. translation. Central Dogma. Replication DNA making a copy of itself Making a replica Transcription
E N D
Nucleic Acid Chemistry Where the info is…interpreting the blueprint
Central Dogma DNA ---------------- RNA-------------- protein Replication transcription translation
Central Dogma • Replication • DNA making a copy of itself • Making a replica • Transcription • DNA being made into RNA • Still in nucleotide language • Translation • RNA being made into protein • Change to amino acid language
Replication • Remember that DNA is self complementary • Replication is semiconservative • One strand goes to next generation • Other is new • Each strand is a template for the other • If one strand is 5’ AGCT 3’ • Other is: 3’ TCGA 5’
Replica • Write the strand complementary to: 3’ ACTAGCCTAAGTCG 5’ Answer
Replication • Roles of enzymes • Topoisomerases • Helicase • DNA polymerases • ligase • DNA binding proteins • DNA synthesis • Leading strand • Lagging strand
Replication • Helix opens • Helicase • Causes supercoiling upstream • Topoisomerases (gyrase) • DNA Binding Proteins • Prevent reannealing
Replication • Leading strand • 3’ end of template • As opens up, DNA polymerase binds • Makes new DNA 5’ - 3’ • Same direction as opening of helix • Made continuously
Replication • Lagging strand • 5’ end of template • Can’t be made continuously as direction is wrong • RNA primer • New DNA made 5’ 3’ • Opposite direction of replication • Discontinuous • Okazaki fragments • Ligase closes gaps
Transcription • DNA template made into RNA copy • Uracil instead of Thymine • One DNA strand is template • Sense strand • Other is just for replication • Antisense (not to be confused with nonsense!) • In nucleus • nucleoli
Transcription • From following DNA strand, determine RNA sequence 3’ GCCTAAGCTCA 5’ Answer
Transcription • DNA opens up • Enzymes? • RNA polymerase binds • Which strand? • Using DNA template, makes RNA • 5’-3’ • Raw transcript called hnRNA
Transcription How does RNA polymerase know where to start? upstream promotor sequences Pribnow Box TATA box RNA polymerase starts transcription X nucleotides downstream of TATA box
Introns and Exons • Introns • Intervening sequences • Not all DNA codes for protein • Regulatory info, “junk DNA” • Exons • Code for protein
Processing of hnRNA into mRNA • 3 steps • Introns removed • Self splicing • 5’ methyl guanosine cap added • Poly A tail added • Moved to cytosol for translation
Translation • RNA -- Protein • Change from nucleotide language to amino acid language • On ribosomes • Vectorial nature preserved • 5’ end of mRNA becomes amino terminus of protein • Translation depends on genetic code
Genetic Code • Nucleotides read in triplet “codons” • 5’ - 3’ • Each codon translates to an amino acid • 64 possible codons • 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities • Degeneracy or redundancy of code • Only 20 amino acids • Implications for mutations
Genetic Code • Not everything translated • AUG is start codon • Find the start codon • Also are stop codons • To determine aa sequence • Find start codon • Read in threes • Continue to stop codon
Translation • Steps: • Find start codon (AUG) • After start codon, read codons, in threes • Use genetic code to translate Translate the following: GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Answer
Translation Process • Requires Ribosomes, rRNA, tRNA and, of course, mRNA • Ribosome • Made of protein and rRNA • 2 subunits • Has internal sites for 2 transfer RNA molecules
Ribosome Left is cartoon diagramRight is actual picture
Transfer RNA • Mostly double stranded • Folds back on itself • Several loops • Anticodon loop • Has complementary nucleotides to codons • 3’ end where aa attach
Translation • Initiation • Ribosomal subunits assemble on mRNA • rRNA aids in binding of mRNA • Elongation • tRNAs with appropriate anticodon loops bind to complex • have aa attached (done by other enzymes) • Amino acids transfer form tRNA 2 to tRNA 1 • Process repeats • Termination • tRNA with stop codon binds into ribosome • No aa attached to tRNA • Complex falls apart
Translation • Happening of process (circa 1971) • http://www.youtube.com/watch?v=u9dhO0iCLww
Mutations • Changes in nucleotide sequence • Can cause changes in aa sequence • Degeneracy in genetic code can prevent • Two types • Point mutations • Single nucleotide changes • Frame shift • Insertions or deletions
Point Mutations • Single nucleotide changes • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUGGGU AGU GAG GCA ACC UGA ACC GAC aa: G S E A T
Point mutations • Depending on change, may not change aa sequence • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUGGGU AGA GAG GCA ACC UGA ACC GAC aa: G R E A T
Point Mutations • Change could make little difference • If valine changed to leucine, both nonpolar • Change could be huge, • Could erase start codon • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUU GGU AGA GAG GCA ACC UGA ACC GAC aa: no start codon…protein not made
Point Mutations • Other possibilities, • Stop codon inserted • Truncated protein • Stop codon changed • Extra long protein • Bottom line, • Depends on what change is
Frame Shift mutations • Insertions or deletions • Change the reading frame • Insertion example Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence AUGGGU AGG AGA GGC AAC CUG AAC CGA C aa: G R R G N L N R
Frame Shift Mutations • Deletion example • Old sequence AUGGGU AGG GAG GCA ACC UGA ACC GAC aa: G R E A T New sequence Delete second A (Underlined above) AUGGGU GGG AGG CAA CCU GAA CCG AC aa: G G R Q P G P
Complementary DNA Strand Template: 3’ ACTAGCCTAAGTCG 5’ 5’ TGATCGGATTCAGC 3’ Back
RNA Transcript DNA 3’ GCCTAAGCTCA 5’ RNA 5’ CGGAUUCGAGU 3’ Back
Translation Answer Find start codon GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Read in threes after that: AUG GGU AGG GAG GCA ACC UGA ACC GAC Using Genetic code AUG GGU AGG GAG GCA ACC UGA ACC GAC G R E A T stop After stop codon…rest is garbage Back