NUCLEIC ACID

1. NUCLEIC ACID Aulanni’am & indra Wibowo Biochemistry Laboratory Chemistry Departement Brawijaya University Aulani "Biokimia" Presentation 9

2. NUCLEIC ACID DNA, RNA, and Flow of Genetic Information DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Aulani "Biokimia" Presentation 9

3. Central Dogma Biology Molecular/ Genetic Information Replication DNA Transcription Reverse Transcription RNA Translation PROTEIN Aulani "Biokimia" Presentation 9

4. Genetic Information ATGGTTTTCAGTGGAGTCATCCTTTCTGCTCTGGTTATGTTTCTGCTTTCTGACAGTGCGCAGTGCAGAAGAGTCGACTGCAAGACTGACTGTTGCTCATTTGTGGAGGGCTTTCCAGTGAGACTCAAGGAGCTCCGTTCTGCATACAGAGAAATACAGAACTTTTATGAGTCCAATGATGACATGGAACCATTACTGGACGAAAACGTGGAACAGAATATCAATA GENETIC CODES Aulani "Biokimia" Presentation 9

5. base base base base base phosphate phosphate phosphate phosphate phosphate sugar sugar sugar sugar sugar Nucleic Acid Structure Structure of Nucleic Acids: Primary structures both are linear polymers (multiple chemical units) composed of monomers (single chemical units), called nucleotides • Functions of Nucleic Acids: • contain the information prescribing amino acid sequence in proteins • serve in the several cellular structures that choose, and then link into • the correct order, the amino acids of a protein chain Aulani "Biokimia" Presentation 9

6. Nucleotides are the Monomeric Units of Nucleic Acid nucleoside nucleotide Aulani "Biokimia" Presentation 9

7. First Component RNA and DNA Differ in the Sugar Component Aulani "Biokimia" Presentation 9

8. Second Component Phosphates Aulani "Biokimia" Presentation 9

9. Phosphodiester Linkage Formation The chain-elongation reaction catalyzed by DNA polymerases is a nucleophilic attack by the 3’-hydroxyl group of the primer on the innermost phosphorus atom of the deoxynucleoside triphosphate Aulani "Biokimia" Presentation 9

10. 3’ linkage 5’ linkage Phosphodiester bond Backbones of DNA and RNA RNA: 3’ 5’ phosphodiester bond 2’ 5’ phosphodiester bond (function in RNA Splicing) Aulani "Biokimia" Presentation 9

11. negative charge Function of the Nucleic Acid Backbones resistance to hydrolysis To maintain the integrity of information stored in nucleic acids Aulani "Biokimia" Presentation 9

12. Third Component Purines and Pyrimidines DNA RNA Aulani "Biokimia" Presentation 9

13. Four Bases as Base Pairs of DNA Specific hydrogen bonding between G and C and between A and T (or A and U) generates complementary base-pairing Aulani "Biokimia" Presentation 9

14. 5’ 4’ 1’ 2’ 3’ β-Glycosidic Linkage in a Nucleoside Aulani "Biokimia" Presentation 9

15. Naming Nucleosides and Nucleotides (Nomenclature) Aulani "Biokimia" Presentation 9

16. Naming Nucleosides and Nucleotides (Nomenclature) Adenosine 5’-triphosphate (5’-ATP)/ 5’-deoxyadenylate Deoxyguanosine 3’-monophosphate (3’-dGMP) Aulani "Biokimia" Presentation 9

17. Structure of a DNA Chain • A DNA chain has polarity. • One end has a free 5’-OH group attach • to a phosphate • Other end has a 3’-OH group • The base sequence is written in • the 5’ to 3’ direction Aulani "Biokimia" Presentation 9

18. A Pair of Nucleic Acid Chains with Complementary Sequences Can Form a Double-Helical Structure X-Ray Diffraction Photograph of a Hydrated DNA Fiber (Maurice Wilkins and Rosalind Franklin) Watson-Crick Model of Double-Helical DNA Aulani "Biokimia" Presentation 9

19. Aulani "Biokimia" Presentation 9

20. Watson-Crick Model of Double Stranded-DNA 34 Å • Helix • Antiparallel, hydrogen bond • Sugar-phosphate backbones outside, bases inside the helix, minor and major grooves • Bases and axis nearly perpedicular • Helix diameter 2 nm (20 Å) • Adjacent bases are separated by 3.4 Å • The helical structure repeats every 34 Å (10 bases/turn) Aulani "Biokimia" Presentation 9

21. The Double Helix is Stabilized by Hydrogen Bonds and Hydrophobic Interactions • The stacking of bases one on top of • another contributes to the stability • of the double helix in two ways: • van der Waals interactions • hydrophobic effect • Rigid five-carbon sugar (pentose) Aulani "Biokimia" Presentation 9

22. Two Possible Helical Forms of DNA are Mirror Images of Each Other The geometry of the sugar-phosphate backbone of DNA causes natural DNA to be right-handed Aulani "Biokimia" Presentation 9

23. Models of Various DNA Structures that are Known to Exist • The B form of DNA, the usual • form in cells, is characterized by • a helical turn every 10 base pairs • (3.4 nm) • The more compact A form of • DNA has 11 base pairs per turn • and exhibits a large tilt of the • base pairs with respect to the • helix axis • Z DNA is a left-handed helix • and has a zig-zag (hence "Z") • appearance Aulani "Biokimia" Presentation 9

24. Some DNA Molecules are Circular and Supercoiled Aulani "Biokimia" Presentation 9

25. The Denaturation and Renaturation of Double-Stranded DNA Molecules Aulani "Biokimia" Presentation 9

26. The Double Helix Facilitates the Accurate Transmission of Hereditary Information DNA Synthesis is catalyzed by DNA Polymerases Occur at all places of DNA chain, 5’3’ direction Semiconservative Aulani "Biokimia" Presentation 9

27. RNA Molecules Exhibit Varied Conformations and Functions • Several Kinds of RNA Play Key Roles in Gene Expression • mRNA (messenger RNA): is the template for protein synthesis or translation • tRNA (transfer RNA): carries amino acids in an activated form to the ribosome for peptide- • bond formation • rRNA (ribosomal RNA): the major component of ribosomes Aulani "Biokimia" Presentation 9

28. Structural Comparisons between DNA and RNA RNA DNA Aulani "Biokimia" Presentation 9

29. Central Dogma Biology Molecular/ Genetic Information DNA Replication Transcription Reverse Transcription RNA Translation PROTEIN Aulani "Biokimia" Presentation 9

30. Transcription mRNA -strand Template strand of DNA (antisense) Coding strand of DNA (sense) +strand • Transcription Mechanism of the Chain-Elongation Reaction • Catalyzed by RNA Polymerase • 5’3’ direction Aulani "Biokimia" Presentation 9

31. Promoter Sites for Transcription Start signals are required for the initiation of RNA synthesis in (A) prokaryotes and (B) eukaryotes Aulani "Biokimia" Presentation 9

32. Transcription, Translation and Reverse Transcription Aulani "Biokimia" Presentation 9

33. The Genetic Code • Three nucleotides encode an amino acid • The code is nonoverlapping • The code has no punctuation • The genetic code is degenerate Aulani "Biokimia" Presentation 9

34. The Genetic Code Codon: A three-nucleotide sequence of DNA or mRNA that specifies a particular amino acid or termination signal; the basic unit of the genetic code Anticodon: A specialized base triplet at one end of a tRNA molecule that recognizes a particular complementary codon on an mRNA molecule Aulani "Biokimia" Presentation 9

35. tRNA and rNA Phenylalanine tRNA of yeast The structure of the rRNA in the small subunit Aulani "Biokimia" Presentation 9

36. RNA Processing Generates Mature RNA intron exon Splicing Aulani "Biokimia" Presentation 9

37. Translation Synthesis of a protein by ribosomes attached to an mRNA molecule. codon anticodon Translation of the mRNA nucleotide sequence into an amino acid sequence depends on complementary base-pairing between codons in the mRNA and corresponding tRNA anticodons. Aulani "Biokimia" Presentation 9

38. Recombinant DNA Technology • Fragmentation, Separation, and • Sequencing of DNA Molecules • DNA Cloning • DNA Engineering Aulani "Biokimia" Presentation 9

39. CIVIC, Madam AATTC G GAATTC AATTC G GAATTC G AATTC AATTC G Recombinant DNA Technology (Palindrome, Restriction Enzyme, Sticky Ends) Sticky Ends (Cohesive Ends) EcoRI Blunt End GAA TTC TTC GAA Aulani "Biokimia" Presentation 9

40. 8 kb 2 kb A 7 kb 3 kb B 5 kb 3 kb 2 kb A + B Recombinant DNA Technology (Restriction Mapping) Restriction enzymes A B 10 kb U A B A+B M - + Aulani "Biokimia" Presentation 9

41. GAATTC GAATTC CTTAAG CTTAAG EcoRI G G G G G AATTC AATTC AATTC AATTC CTTAA CTTAA CTTAA CTTAA CTTAA G G G G EcoRI sticky end EcoRI sticky end DNA Ligase AATTC G Recombinant DNA Technology (Restriction and Ligation) Aulani "Biokimia" Presentation 9

42. Recombinant DNA Technology (Random Fragment Length Polymorfism) Aulani "Biokimia" Presentation 9

43. Recombinant DNA Technology (Random Fragment Length Polymorfism) recombination Aulani "Biokimia" Presentation 9

44. Recombinant DNA Technology (Sequencing) Sanger Method: ddNTP H H Dideoxyadenosine 5’-triphosphate (ddNTP) Aulani "Biokimia" Presentation 9

45. Drug Resistant Gene mRNA Recombinant DNA Technology (DNA Cloning: Drug Resistance Gene Transferred by Plasmid ) Plasmid Resistant Strain Plasmid gets out and into the host cell Enzyme Hydrolyzing Antibiotics New Resistance Strain Non-resistant Strain Aulani "Biokimia" Presentation 9

46. Recombinant DNA Technology (DNA Cloning: Target Genes Carried by Plasmid) Chromosomal DNA Restriction Enzyme Restriction Enzyme Target Genes DNA Recombination Target Gene Recombination Transformation 1 plasmid 1 cell Host Cells Recombinant Plasmid Transformation Aulani "Biokimia" Presentation 9

47. Recombinant DNA Technology (DNA Cloning: Amplification and Screening of Target Gene) 1 Plating 1 cell line, 1 colony Plasmid Duplication X100 Bacteria Duplication X1,000 Pick the colony containing target gene Aulani "Biokimia" Presentation 9 =100,000

48. exon exon exon intron intron 5’ 3’ 5’ 3’ Recombinant DNA Technology (Libraries: Intron and Exon Organization) DNA promotor stop codon start codon Transcription mRNA Processing cap poly A tail Splicing Intron deleted mature mRNA To cytoplasm Take place in nucleus Aulani "Biokimia" Presentation 9

49. 5’ 3’ 3’ 5’ 5’ Recombinant DNA Technology (Libraries: cDNA Synthesis) mature mRNA poly A tail Reverse transcription TTTT 3’ 5’ RNA hydrolysis DNA polymerase 3’ CCC 5’ GGG 3’ Aulani "Biokimia" Presentation 9

50. Recombinant DNA Technology (Libraries: cDNA and Genomic) Genes in expression Total Gene Chromosomal DNA mRNA Reverse transcription Restriction digestion Complete gene cDNA Gene fragments Smaller Library Larger Library Vector: Plasmid or phage Vector: Plasmid Aulani "Biokimia" Presentation 9