binta
Uploaded by
55 SLIDES
1162 VUES
690LIKES

NUCLEIC ACID

DESCRIPTION

NUCLEIC ACID. Aulanni’am & indra Wibowo Biochemistry Laboratory Chemistry Departement Brawijaya University. NUCLEIC ACID. DNA, RNA, and Flow of Genetic Information. DNA (deoxyribonucleic acid) RNA (ribonucleic acid ). Central Dogma Biology Molecular/ Genetic Information. Replication.

1 / 55

Download Presentation
Télécharger la présentation

NUCLEIC ACID

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. NUCLEIC ACID Aulanni’am & indra Wibowo Biochemistry Laboratory Chemistry Departement Brawijaya University Aulani "Biokimia" Presentation 9

  2. NUCLEIC ACID DNA, RNA, and Flow of Genetic Information DNA (deoxyribonucleic acid) RNA (ribonucleic acid) Aulani "Biokimia" Presentation 9

  3. Central Dogma Biology Molecular/ Genetic Information Replication DNA Transcription Reverse Transcription RNA Translation PROTEIN Aulani "Biokimia" Presentation 9

  4. Genetic Information ATGGTTTTCAGTGGAGTCATCCTTTCTGCTCTGGTTATGTTTCTGCTTTCTGACAGTGCGCAGTGCAGAAGAGTCGACTGCAAGACTGACTGTTGCTCATTTGTGGAGGGCTTTCCAGTGAGACTCAAGGAGCTCCGTTCTGCATACAGAGAAATACAGAACTTTTATGAGTCCAATGATGACATGGAACCATTACTGGACGAAAACGTGGAACAGAATATCAATA GENETIC CODES Aulani "Biokimia" Presentation 9

  5. base base base base base phosphate phosphate phosphate phosphate phosphate sugar sugar sugar sugar sugar Nucleic Acid Structure Structure of Nucleic Acids: Primary structures both are linear polymers (multiple chemical units) composed of monomers (single chemical units), called nucleotides • Functions of Nucleic Acids: • contain the information prescribing amino acid sequence in proteins • serve in the several cellular structures that choose, and then link into • the correct order, the amino acids of a protein chain Aulani "Biokimia" Presentation 9

  6. Nucleotides are the Monomeric Units of Nucleic Acid nucleoside nucleotide Aulani "Biokimia" Presentation 9

  7. First Component RNA and DNA Differ in the Sugar Component Aulani "Biokimia" Presentation 9

  8. Second Component Phosphates Aulani "Biokimia" Presentation 9

  9. Phosphodiester Linkage Formation The chain-elongation reaction catalyzed by DNA polymerases is a nucleophilic attack by the 3’-hydroxyl group of the primer on the innermost phosphorus atom of the deoxynucleoside triphosphate Aulani "Biokimia" Presentation 9

  10. 3’ linkage 5’ linkage Phosphodiester bond Backbones of DNA and RNA RNA: 3’ 5’ phosphodiester bond 2’ 5’ phosphodiester bond (function in RNA Splicing) Aulani "Biokimia" Presentation 9

  11. negative charge Function of the Nucleic Acid Backbones resistance to hydrolysis To maintain the integrity of information stored in nucleic acids Aulani "Biokimia" Presentation 9

  12. Third Component Purines and Pyrimidines DNA RNA Aulani "Biokimia" Presentation 9

  13. Four Bases as Base Pairs of DNA Specific hydrogen bonding between G and C and between A and T (or A and U) generates complementary base-pairing Aulani "Biokimia" Presentation 9

  14. 5’ 4’ 1’ 2’ 3’ β-Glycosidic Linkage in a Nucleoside Aulani "Biokimia" Presentation 9

  15. Naming Nucleosides and Nucleotides (Nomenclature) Aulani "Biokimia" Presentation 9

  16. Naming Nucleosides and Nucleotides (Nomenclature) Adenosine 5’-triphosphate (5’-ATP)/ 5’-deoxyadenylate Deoxyguanosine 3’-monophosphate (3’-dGMP) Aulani "Biokimia" Presentation 9

  17. Structure of a DNA Chain • A DNA chain has polarity. • One end has a free 5’-OH group attach • to a phosphate • Other end has a 3’-OH group • The base sequence is written in • the 5’ to 3’ direction Aulani "Biokimia" Presentation 9

  18. A Pair of Nucleic Acid Chains with Complementary Sequences Can Form a Double-Helical Structure X-Ray Diffraction Photograph of a Hydrated DNA Fiber (Maurice Wilkins and Rosalind Franklin) Watson-Crick Model of Double-Helical DNA Aulani "Biokimia" Presentation 9

  19. Aulani "Biokimia" Presentation 9

  20. Watson-Crick Model of Double Stranded-DNA 34 Å • Helix • Antiparallel, hydrogen bond • Sugar-phosphate backbones outside, bases inside the helix, minor and major grooves • Bases and axis nearly perpedicular • Helix diameter 2 nm (20 Å) • Adjacent bases are separated by 3.4 Å • The helical structure repeats every 34 Å (10 bases/turn) Aulani "Biokimia" Presentation 9

  21. The Double Helix is Stabilized by Hydrogen Bonds and Hydrophobic Interactions • The stacking of bases one on top of • another contributes to the stability • of the double helix in two ways: • van der Waals interactions • hydrophobic effect • Rigid five-carbon sugar (pentose) Aulani "Biokimia" Presentation 9

  22. Two Possible Helical Forms of DNA are Mirror Images of Each Other The geometry of the sugar-phosphate backbone of DNA causes natural DNA to be right-handed Aulani "Biokimia" Presentation 9

  23. Models of Various DNA Structures that are Known to Exist • The B form of DNA, the usual • form in cells, is characterized by • a helical turn every 10 base pairs • (3.4 nm) • The more compact A form of • DNA has 11 base pairs per turn • and exhibits a large tilt of the • base pairs with respect to the • helix axis • Z DNA is a left-handed helix • and has a zig-zag (hence "Z") • appearance Aulani "Biokimia" Presentation 9

  24. Some DNA Molecules are Circular and Supercoiled Aulani "Biokimia" Presentation 9

  25. The Denaturation and Renaturation of Double-Stranded DNA Molecules Aulani "Biokimia" Presentation 9

  26. The Double Helix Facilitates the Accurate Transmission of Hereditary Information DNA Synthesis is catalyzed by DNA Polymerases Occur at all places of DNA chain, 5’3’ direction Semiconservative Aulani "Biokimia" Presentation 9

  27. RNA Molecules Exhibit Varied Conformations and Functions • Several Kinds of RNA Play Key Roles in Gene Expression • mRNA (messenger RNA): is the template for protein synthesis or translation • tRNA (transfer RNA): carries amino acids in an activated form to the ribosome for peptide- • bond formation • rRNA (ribosomal RNA): the major component of ribosomes Aulani "Biokimia" Presentation 9

  28. Structural Comparisons between DNA and RNA RNA DNA Aulani "Biokimia" Presentation 9

  29. Central Dogma Biology Molecular/ Genetic Information DNA Replication Transcription Reverse Transcription RNA Translation PROTEIN Aulani "Biokimia" Presentation 9

  30. Transcription mRNA -strand Template strand of DNA (antisense) Coding strand of DNA (sense) +strand • Transcription Mechanism of the Chain-Elongation Reaction • Catalyzed by RNA Polymerase • 5’3’ direction Aulani "Biokimia" Presentation 9

  31. Promoter Sites for Transcription Start signals are required for the initiation of RNA synthesis in (A) prokaryotes and (B) eukaryotes Aulani "Biokimia" Presentation 9

  32. Transcription, Translation and Reverse Transcription Aulani "Biokimia" Presentation 9

  33. The Genetic Code • Three nucleotides encode an amino acid • The code is nonoverlapping • The code has no punctuation • The genetic code is degenerate Aulani "Biokimia" Presentation 9

  34. The Genetic Code Codon: A three-nucleotide sequence of DNA or mRNA that specifies a particular amino acid or termination signal; the basic unit of the genetic code Anticodon: A specialized base triplet at one end of a tRNA molecule that recognizes a particular complementary codon on an mRNA molecule Aulani "Biokimia" Presentation 9

  35. tRNA and rNA Phenylalanine tRNA of yeast The structure of the rRNA in the small subunit Aulani "Biokimia" Presentation 9

  36. RNA Processing Generates Mature RNA intron exon Splicing Aulani "Biokimia" Presentation 9

  37. Translation Synthesis of a protein by ribosomes attached to an mRNA molecule. codon anticodon Translation of the mRNA nucleotide sequence into an amino acid sequence depends on complementary base-pairing between codons in the mRNA and corresponding tRNA anticodons. Aulani "Biokimia" Presentation 9

  38. Recombinant DNA Technology • Fragmentation, Separation, and • Sequencing of DNA Molecules • DNA Cloning • DNA Engineering Aulani "Biokimia" Presentation 9

  39. CIVIC, Madam AATTC G GAATTC AATTC G GAATTC G AATTC AATTC G Recombinant DNA Technology (Palindrome, Restriction Enzyme, Sticky Ends) Sticky Ends (Cohesive Ends) EcoRI Blunt End GAA TTC TTC GAA Aulani "Biokimia" Presentation 9

  40. 8 kb 2 kb A 7 kb 3 kb B 5 kb 3 kb 2 kb A + B Recombinant DNA Technology (Restriction Mapping) Restriction enzymes A B 10 kb U A B A+B M - + Aulani "Biokimia" Presentation 9

  41. GAATTC GAATTC CTTAAG CTTAAG EcoRI G G G G G AATTC AATTC AATTC AATTC CTTAA CTTAA CTTAA CTTAA CTTAA G G G G EcoRI sticky end EcoRI sticky end DNA Ligase AATTC G Recombinant DNA Technology (Restriction and Ligation) Aulani "Biokimia" Presentation 9

  42. Recombinant DNA Technology (Random Fragment Length Polymorfism) Aulani "Biokimia" Presentation 9

  43. Recombinant DNA Technology (Random Fragment Length Polymorfism) recombination Aulani "Biokimia" Presentation 9

  44. Recombinant DNA Technology (Sequencing) Sanger Method: ddNTP H H Dideoxyadenosine 5’-triphosphate (ddNTP) Aulani "Biokimia" Presentation 9

  45. Drug Resistant Gene mRNA Recombinant DNA Technology (DNA Cloning: Drug Resistance Gene Transferred by Plasmid ) Plasmid Resistant Strain Plasmid gets out and into the host cell Enzyme Hydrolyzing Antibiotics New Resistance Strain Non-resistant Strain Aulani "Biokimia" Presentation 9

  46. Recombinant DNA Technology (DNA Cloning: Target Genes Carried by Plasmid) Chromosomal DNA Restriction Enzyme Restriction Enzyme Target Genes DNA Recombination Target Gene Recombination Transformation 1 plasmid 1 cell Host Cells Recombinant Plasmid Transformation Aulani "Biokimia" Presentation 9

  47. Recombinant DNA Technology (DNA Cloning: Amplification and Screening of Target Gene) 1 Plating 1 cell line, 1 colony Plasmid Duplication X100 Bacteria Duplication X1,000 Pick the colony containing target gene Aulani "Biokimia" Presentation 9 =100,000

  48. exon exon exon intron intron 5’ 3’ 5’ 3’ Recombinant DNA Technology (Libraries: Intron and Exon Organization) DNA promotor stop codon start codon Transcription mRNA Processing cap poly A tail Splicing Intron deleted mature mRNA To cytoplasm Take place in nucleus Aulani "Biokimia" Presentation 9

  49. 5’ 3’ 3’ 5’ 5’ Recombinant DNA Technology (Libraries: cDNA Synthesis) mature mRNA poly A tail Reverse transcription TTTT 3’ 5’ RNA hydrolysis DNA polymerase 3’ CCC 5’ GGG 3’ Aulani "Biokimia" Presentation 9

  50. Recombinant DNA Technology (Libraries: cDNA and Genomic) Genes in expression Total Gene Chromosomal DNA mRNA Reverse transcription Restriction digestion Complete gene cDNA Gene fragments Smaller Library Larger Library Vector: Plasmid or phage Vector: Plasmid Aulani "Biokimia" Presentation 9

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer