260 likes | 273 Vues
This presentation discusses the concept, usage, and future of Moby for data integration in biology. It explores how biologists can use tools like Seahawk and DNASequence NCBI_gi to align sequences and collaborate with service providers. The audience includes bioinformaticians and biologists interested in data integration. The speaker will also cover the principles of Moby and the importance of collaboration in scientific research.
E N D
Breaking Barriers:getting biologists involved in everyday data integration using Moby Paul Gordon Genome Canada Bioinformatics Platform University of Calgary, Canada
Outline • concept, usage, future • Getting Biologists Involved: Seahawk &
DNASequence NCBI_gi Sequence_Alignment
Core Moby Service Providers in Europe
As OWL AxiomsHomologousMutantImage is owl:equivalentTo { Gene Q hasImage image P Gene Q hasSequence Sequence Q Gene R hasSequence Sequence R Sequence Q similarTo Sequence R Gene R = “my gene of interest” }
Paul’s Maxims • You cannot get rid of work • You can: • Distribute work amongst parties with vested interests & required capabilities • Avoid redoing the same work repeatedly
Agenda • Motivation • Audience • Mechanism
Larry Wall’s “Virtues of a Programmer” HUBRIS IMPATIENCE LAZINESS
Audience Willing to take training Capable but no hubris Taverna self-starters Amoeba God Self-perception of computer skills
Man’s Prayer Bioinformatician • I’m a man… • But I can change… • If I have to… • I guess…
Take the output of the U of C service and send it to iHOP, then send its output to DDBJ’s service…
Semantic Annotations for WSDL Moby SAWSDL
MOB Rule Syntax >gi|12434353 glycerol kinase cgatcagcatcgactagcatcgactatttgctatcat cagctacgatcagctacgactac…
Shared Responsibility • Service Providers • Proxy Provider • Third Party Developers • Biologists Tu deviens responsable pour toujours de ce que tu as apprivoisé.
SAWSDL Required Infrastructure Calgary Anywhere Compute Cloud (e.g. Calgary or Google App Engine) Anywhere Calgary (Sun v240)
To Do • Formal user studies • HTML Form wrapping • Enactment portal • Biocatalogue? If you can not measure it, you can not improve it. – Lord Kelvin