eavan
Uploaded by
30 SLIDES
667 VUES
310LIKES

Biology Booklet

DESCRIPTION

First semester. Biology Booklet. Grade 10 Advanced. Unit 4. DNA and protein synthesis. Name :------------------------------------------ Class :-------------------. Grade 10 Advanced Unit4:DNA&Protein synthesis. Booklet key. Key words. links. Exercises.

1 / 30

Download Presentation
Télécharger la présentation

Biology Booklet

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. First semester Biology Booklet Grade 10 Advanced Unit4 DNA and protein synthesis Name :------------------------------------------ Class :-------------------

  2. Grade 10 Advanced Unit4:DNA&Protein synthesis Booklet key Key words links Exercises Reading text for improving language only

  3. Grade 10 Advanced Unit4:DNA&Protein synthesis Contents

  4. Grade 10 Advanced Unit4:DNA&Protein synthesis Unit 4 DNA & Protein synthesis Standards: 10A.11.1 Describe the double-helix structure and semi-conservative replication of DNA, and recognise the importance of the base pairings. يصف التركيب الحلزوني المزدوج لجزئ ال د ن أ والاستساخ الذاتي ويدرك أهمية تزاوج قواعد هذا الجزئ . 10A.11.2Describe the role of DNA, mRNA and tRNA in protein synthesis and understand how a base sequence on DNA controls the structure and function of a protein يصف دور كلا من د ن أ ، ر ن أ الرسول ، ر ن أ الناقل في بناء البروتينات ، ويفهم كيف أن تتابع القواعد في جزئ د ن أ يتحكم في تركيب ووظيفة البروتين . 10A.11.3Know that the base sequence on DNA forms the genetic code and is passed from generation to generation يعرف أن تتابع القواعد في ال د ن أ هو الذي يشكل الشفرة الوراثية أو الجينية ، وأنه ينتقل من جيل إلى آخر . 1

  5. Grade 10 Advanced Unit4:DNA&Protein synthesis Key Words 2

  6. Grade 10 Advanced Unit4:DNA&Protein synthesis The structure of DNA and RNAتركيب ال د ن أ & ال ر ن أ Genetic material of living organisms is either DNA or RNA. DNA – Deoxyribonucleic acid RNA – Ribonucleic acid Genes :are lengths of DNA that code for particular proteins. • Both DNA and RNA are polynucleotide's. • They are made up of smaller molecules called nucleotides. • DNA is made of two polynucleotide strands: • RNA is made of a single polynucleotide strand: • تتكون المادة الوراثية في الكائنات الحية من الحمض النووي د ن أ أو ر ن ا • د ن أ : الحمض النووي منقوص الأكسجين • ر ن أ : الحمض النووي كامل الأكسجين • الجينات : هي أجزاء من ال د ن أ ، وكل جين يعبرعن بروتين محدد . • يعتبر الحمضين د ن أ ، ر ن أ من النيوكليوتيدات المتعددة . • يتكون كلاهما من من جزيئات صغيرة تدعى ( نيوكليوتايد ) • يتكون ال د ن أ من خيطين من النيوكليوتيدات المتعددة . • يتكون ال ر ن أ من خيط واحد من النيوكليوتيدات المتعددة . Deoxyribonucleic acid nucleotides polynucleotide's. Ribonucleic acid strand Genes 3

  7. Grade 10 Advanced Unit4:DNA&Protein synthesis Structure of a nucleotideتركيب النيوكليوتيدة A nucleotide is made of 3 components: 1- A Pentose sugar This is a 5 carbon sugar The sugar in DNA is deoxyribose. The sugar in RNA is ribose. 2- APhosphate group Phosphate groups are important because they link the sugar on one nucleotide onto the phosphate of the next nucleotide to make a polynucleotide. • 3- ANitogenous base • In DNA the four bases are: • Thymine (Uracil in RNA) • Adenine • Cytosine • Guanine تتكون النيوكليوتيدة من 3 أجزاء : 1 - سكر خماسي : يتكون من 5 ذرات كربون ، ففي ال د ن أ يسمى السكر ( رايبوز منقوص الأكسجين ) . أما في ال ر ن أ فيسمى السكر ( رايبوز ) . 2- مجموعة فوسفات : تعتبر مجموعة الفوسفات مهمة لأنها تصل السكر الموجود على النيوكليوتيدة بالفوسفات الموجود على النيوكليوتيدة التالية لتكوين النيوكليوتيدات المتعددة . 3- قاعدة نيتروجينية : توجد أربعة قواعد في د ن أ : ثايمين ( يوراسيل في ر ن أ ) أدينين سايتوسين جوانين Nitogenous base Cytosine Pentose sugar Uracil Adenine Guanine Thymine 4

  8. Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises Question 1: Look at the DNA diagram and answer the following questions: السؤال الأول : انظر إلى نموذج ال د ن أ المرفق ، ثم أجب على الأسئلة التالية : • Circle a nucleotide - ضع دائرة على نيوكليوتيدة كاملة • Label the sugar and phosphate - حدد السكر والفوسفات • Label the bases that are not already labeled - حدد القواعد التي لم يتم تحديدها • The two sides of the DNA helix are held together by ____ _______bond - يرتبط خيطين ال د ن أ مع بعض بواسطة ____ • The amount of adenine is always equal to the amount of___________ and the amount of guanine is always equal to the amount of _____________ • - دائما تتساوى أعداد قواعد الأدنين مع أعداد قواعد ________ • كما تتساوى أعداد قواعد الجوانين مع أعداد قواعد _________ 5

  9. Grade 10 Advanced Unit4:DNA&Protein synthesis Nitrogenous bases القواعد النيتروجينية Pyramidines البريميدينات Adenine - A Guanine - G Purines البيورينات Thymine - T Cytosine - C Uracil - U Base-PairingRule قانون ربط القواعد النيتروجينية : A always pairs with T C always pairs with G يرتبط الأدينين دائماً مع الثايمين يرتبط السايتوسين دائماً مع الجوانين http://student.ccbcmd.edu/biotutorials/dna/dnareppr.html 6

  10. Grade 10 Advanced Unit4:DNA&Protein synthesis Sugar phosphate bonds (backbone of DNA)روابط السكر والفوسفات ( العمود الفقري لجزئ ال د ن أ ) Nucleotides are connected to each other by the phosphate on one nucleotide and the sugar on the next nucleotide to form a Polynucleotide ترتبط النيوكليوتيدات مع بعضها البعض بواسطة ارتباط مجموعة الفوسفات من النيوكليوتيدة السابقة بالسكر الموجود في النيوكليوتيدة اللاحقة ، لتكوين النيوكليوتيدات المتعددة . nucleotide bases joined weakly in the middle by hydrogen bonds. ترتبط القواعد الموجودة في النيوكليوتيدات بالوسط مع بعضها البعض بواسطة روابط هيدروجينية ضعيفة . 7

  11. Grade 10 Advanced Unit4:DNA&Protein synthesis Base pairingر بط القواعد النيتروجينية The Nitrogenous Bases pair up with other bases. For example the bases of one strand of DNA base pair with the bases on the opposite strand of the DNA. ترتبط القواعد النيتروجينية مع بعضها البعض في جزئ ال د ن أ ، بحيث ترتبط القواعد الموجودة على أحد الخيطين مع القواعد المتممة لها على الخيط الآخر وفق قانون الربط السابق . 8

  12. Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises • Question 1: Fill the space with the correct answer • السؤال الأول : أملئ الفراغات التالية بالكلمات المناسبة : • There are 2 types of nucleic acids: ___________ and ____________ • 1- هناك نوعان من الأحماض النووية هما ________________ و ___________ • 2 . The 5 nitrogen bases are divided into two groups: • Purines which include ___________________ and _______________ • Pyrimidines which are ______________, _______________ and ________________ • 2- هناك 5 أنواع من القواعد النيتروجينية والتي تم تصنيفها إلى مجموعتين أساسيتين : • البيورينات : والتي تشمل _______________ و _______________ • والبيريميدينات : والتي تشمل _______________ و _______________ Question 2: Choose a color for each part of the nucleotide and fill in the square with the color of your choice. Color the part to match. السؤال الثاني : لون المربع الموجود أمام كل جزء باللون الذي يعبر عنه في نموذج أسفل : Phosphate Pentose Sugar Nitrogen Base فوسفات سكر خماسي قاعدة نيتروجينية 9

  13. Grade 10 Advanced Unit4:DNA&Protein synthesis Question 3 Fill out the following table comparing DNA and RNA: السؤال الثالث : إملأ الجدول التالي للمقارنة بين ال د ن أ و ال ر ن أ : 10

  14. Grade 10 Advanced Unit4:DNA&Protein synthesis DNA Replication نســـخ ال د ن أ It means the copying of DNA. It is described as semi-conservative replication. This means that the DNA molecule replicate and produce new molecule with both old and new one. Each daughter DNA composed of old strand and new strand. DNA replication occurs just before cell division. ويعني مضاعفة ال د ن أ ونسخه ، ويتم فيه اصدار نسخة إضافية مع المحافظة على النسخة الأصلية ، بمعنى أنه يتم نسخ جزئ ال د ن أ لإنتاج جزئ جديد مع البقاء على الجزئ الأصلي ، وكل جزئ جديد من ال د ن أ يتكون من خيطين ( شريطين ) أحدهما قديم – من الأصلي – والأخر جديد يتم تصنيعه ، وتتم عملية النسخ قبل الدخول مباشرة في الانقسام الخلوي . Replication semi-conservative composed cell division. حلزون ال د ن أ الأصلي جزيئين ال د ن أ بعد عملية نسخ واحدة 11

  15. Grade 10 Advanced Unit4:DNA&Protein synthesis Meselson and Stahl (1958)نموذج ميسيلسون & ستال 1958 http://users.rcn.com/jkimball.ma.ultranet/ BiologyPages/M/Meselson_Stahl.html 12

  16. Grade 10 Advanced Unit4:DNA&Protein synthesis Exercises Question 1: with the reference to the figure below answer the following questions: السؤال الأول : بالرجوع للصورة أسفل ، أجب على الأسئلة التالية : (a) (b) (c) (d) • DNA replication occurs just before a cell _________________ • 1- تقوم الخلية بنسخ ال د ن أ قبل دخولها في ____________ • 2 . The process of making a copy of DNA is described as __________________ • 2- تسمى العملية التي يتم فيها نسخ جزئ د ن أ بال ______________ • 3 . Which of the above represents: • 3- اختر من الأجزاء الأربعة السابقة ما يعبر عن • - The parental DNA? ____________ • جزئ ال د ن أ الأصلي • - The daughter DNA? _____________ • جزئ ال د ن أ المنسوخ ( الجديد ) 13

  17. Question 2: For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after replication. السؤال الثاني : لكل شريط ( أو خيط ) من أشرطة ال د ن أ التالية ، اكتب الشريط أو الخيط المتمم له بعد عملية النسخ DNA moleculeالجزئ الأول#1: TACCGGATGCCAGATCAAATC Complementary DNAجزئ د ن أ المتمم #1 ________________________________ DNA molecule الجزئ الثاني #2: TACGGGGGCGTAACCACAACT Complementary DNA جزئ د ن أ المتمم #2_________________________________ DNA molecule الجزئ الثالث #3: TACCTGTTAAGCTACAAAATT Complementary DNA جزئ د ن أ المتمم #3_________________________________ Grade 10 Advanced Unit4:DNA&Protein synthesis 14

  18. Grade 10 Advanced Unit4:DNA&Protein synthesis The genetic code الشفرة الوراثية genetic code triplets codon It’s the information needed to make particular protein from DNA molecule. Its made up of three bases triplets) . the sequence of bases or triplets is called codon. ATC CTG TAG Each codon matches certain amino acid. Many amino acids make peptide to give protein this is known as protein synthesis protein synthesis peptide هي المعلومات الواجب توفرها لتكوين بروتين محدد من جزئ ال د ن أ ، وتتكون من 3 قواعد نيتروجينية يطلق عليها الشفرة . وكل شفرة وراثية تعبر عن حمض أميني واحد ، ومجموعة الأحماض تتحد مع بعض لتكوين الببتيد ليعطي البروتين .وهو مايسمى ببناء البروتين 15

  19. Grade 10 Advanced Unit4:DNA&Protein synthesis mRNA DNA PROTEIN DNA, protein synthesis, mRNA and tRNA د ن أ ، بناء البروتين ، ر ن أ الرسول ، ر ن أ الناقل Protein Synthesis It is the formation of protein from DNA molecule using the genetic code by transcription and translation. بناء البروتين : ويقصد به تكوين البروتين من جزئ د ن أ باستخدام الشفرة الوراثية بواسطة عمليتي النسخ والترجمة . د ن أ ر ن أ الرسول بروتين formation mRNA transcription tRNA translation www.biostudio.com/demo_freeman_protein_synthesis.htm 16

  20. Grade 10 Advanced Unit4:DNA&Protein synthesis 1- Transcription أولا ً : عملية النسخ It is to change DNA in to RNA (messenger RNA) in the nucleus according base pairing (A-U) and (G-C) هي عملية تغيير ال د ن أ إلى ر ن أ الرسول في النواة وفقاً لقانون ربط القواعد ( الأدنين واليوراسيل ) و ( الجوانين والسايتوسين ) . DNA TAGGACATCCGC mRNA UAGGACAUCCGC Transcription happened because mRNA can leave the nucleus but DNA can’t. تحدث عملية النسخ لأن ر ن أ الرسول يستطيع مغادرة النواة ، بينما د ن أ لا يستطيع . • Transcription steps • 1. Unwind one gene in the DNA. • 2. match up bases of RNA to one side DNA ( A binds T), ( C binds G) • 3. mRNA detaches from the DNA. • 4. mRNA moves out of the nucleolus into the cytoplasm. • Genetic code= Codon= triple code, they code for specific amino acid. • خطوات عملية النسخ : • 1- ينفك أو ينحل جين واحد من جزئ ال د ن أ . • 2- يتم ربط قواعد ال ر ن أ في جانب واحد من ال د ن أ ( الأدينين مع الثايمين ، والسايتوسين مع الجوانين ) . • 3- ينفصل ر ن أ الرسول من ال د ن أ . • 4- يترك ر ن أ الرسول النوية ويخرج إلى السيتوبلازم . • الشفرة الوراثية = الكودون = الشفرة الثلاثية • وكل شفرة خاصة بتكوين حمض أميني محدد . 17

  21. Grade 10 Advanced Unit4:DNA&Protein synthesis 2- Translation ( process of making a protein) ثانياً : عملية الترجمة ( عملية صناعة البروتين ) is the process of using codedmRNA instructions for a sequence of amino acids to produce a polypeptide tRNA is short RNA with one codon matches the mRNA called anti codon and amino acid match the anticodon. Protein synthesis happened in the ribosome. هي عملية استخدام الشفرات الموجودة في ال ر ن أ الرسول لتكوين تتابعات من الأحماض الأمينية تؤدي لإنتاج عديد الببتيد . ويعتبر ال ر ن أ الناقل أقصر ر ن أ ، فهو يتكون من كودون واحد متصل بال ر ن أ الرسول ويسمى مضاد الكودون ، ويتصل الحمض الأميني بمضاد الكودون . كما تحدث عملية بناء البروتين في الرايبوسوم . m RNA UAGGACAUCCGC t RNA AUC CUG UAG GCG Peptides Amb Asp lleu Arg (amino acids) different codons mean different amino acids ( الأحماض الأمينية ) : اختلاف الكودونات يعني اختلاف الأحماض الأمينية تتابع القواعد على ر ن أ الرسول تتابع القواعد على ر ن أ الناقل الأحماض الأمينية الناتجة تبعاً للقواعد السابقة 18

  22. Grade 10 Advanced Unit4:DNA&Protein synthesis Translation steps 1. mRNA attaches to a ribosome 2. Transfer RNA( tRNA) brings amino acids to build up a copy peptide. 3. Anticodon (3 bases on tRNA) matches up Codon on mRNA . 4. Protein( chain of amino acids) detaches of ribosome and goes of to work. Different Codons means different amino acids. خطوات الترجمة : 1- يرتبط ال ر ن أ الرسول بالرايبوسوم . 2- يقوم ال ر ن أ الناقل بإحضار الأحماض الأمينية لبناء نسخة من الببتيد ( بروتين ) . 3- مضاد الكودون ( 3 قواعد على ال ر ن أ الناقل ) تتصل بالكودون على ال ر ن أ الرسول . 4- ينفصل البروتين ( سلسلة من الأحماض الأمينية ) من الرايبوسوم ويذهب لأداء وظيفته . الكودونات المختلفة تعني أحماض أمينية مختلفة . ribosome 19

  23. Grade 10 Advanced Unit4:DNA&Protein synthesis Question 1 : For each of the same DNA sequences below, write the sequence of messenger RNA codons that is synthesized during transcription. Be sure to separate the codons into triplets. السؤال الاول : اكتب الكودونات التي ستتكون على ال ر ن أ الرسول وفقاً للتابعات الموجودة على ال د ن أ والتي ستبني البروتينات أثناء عملية النسخ ( تأكد أن كل كودون عبارة عن 3 قواعد فقط ): DNA molecule #1: TACCGGATGCCAGATCAAATC mRNA #1 _____________________________________________________ DNA molecule #2: TACGGGGGCGTAACCACAACT mRNA #2___________________________________________________ DNA molecule #3: TACCTGTTAAGCTACAAAATT mRNA #3__________________________________________________ Exercises 20

  24. Grade 10 Advanced Unit4:DNA&Protein synthesis B) :for each of the mRNA codon sequences you have written, determine the sequence of tRNA anticodons that match it. ب ) : اكتب تتابع القواعد النيتروجينية لمضاد الكودون على ال ر ن أ الناقل تبعاُ للكودونات الموجودة على ال ر ن أ الرسول التي تم كتابتها في الخطوة السابقة : Anticodons for mRNA #1: ___________________________________________ Anticodons for mRNA #2: ___________________________________________ Anticodons for mRNA #3: ___________________________________________ Question 2 : Using the chart below, write the amino acid sequence coded for by each mRNA. Polypeptide #1: __________________________________________________ Polypeptide #2: __________________________________________________ Polypeptide #3: __________________________________________________ 21

  25. Grade 10 Advanced Unit4:DNA&Protein synthesis Question 3: Look at the diagram below and answer the following questions: السؤال الثالث : انظر للرسم بالأسفل ، ثم أجب على الأسئلة التالية : This stage is called تسمى هذه المرحلة ب ________ This stage is called ____________ تسمى هذه المرحلة ب ______________ a) Label the following: protein, mRNA, ribosome, DNA b) DNA transcription takes place in the _________ of the cell whereas the translation occur in the cell _____________ أ ) ضع البيانات التالية على الرسمة : بروتين - ر ن أ الرسول - رايبوسوم _ د ن أ ب ) تحدث عملية نسخ ال د ن أ في ______________ الخلية ، بينما تحدث عملية الترجمة في _________________ . 22

  26. Grade 10 Advanced Unit4:DNA&Protein synthesis Question4 :For each of the same DNA sequences below, write the sequence of messenger RNA codons that is synthesized during transcription. Be sure to separate the codons into triplets. السؤال الرابع : اكتب القواعد النيتروجينية ( الكودونات ) على ال ر ن أ الرسول والتي سيتم تكوينها أثناء عملية النسخ ، لكل سلسلة من سلاسل ال د ن أ التالية : ( تأكد من كتابة القواعد على شكل شفرات ثلاثية ) : DNA molecule #1: TACCGGATGCCAGATCAAATC mRNA #1 ____________________________________________ DNA molecule #2: TACGGGGGCGTAACCACAACT mRNA #2________________________________________________ DNA molecule #3: TACCTGTTAAGCTACAAAATT mRNA #3_______________________________________________ جزئ ال د ن أ الأول : الكودونات على ال ر ن أ الرسول للجزئ الأول جزئ ال د ن أ الثاني : الكودونات على ال ر ن أ الرسول للجزئ الثاني جزئ ال د ن أ الثالث : الكودونات على ال ر ن أ الرسول للجزئ الثالث 23

  27. Grade 10 Advanced Unit4:DNA&Protein synthesis 10 minutes (max) READING ACTIVITY Question5 :Read the text below then answer the following questions. السؤال الخامس : أقرأ النص التالي ثم أجب على الأسئلة التالية : Life is specified by genomes , Every organism, including humans, has a genome that contains all of the biological information needed to build and maintain a living example of that organism. The biological information contained in a genome is encoded in its DNA and is divided into discrete units called Genes . 3- Write a summary for the above text. 3 - لخص النص السابق بأسلوبك ……………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………………… 24

  28. Grade 10 Advanced Unit4:DNA&Protein synthesis المشروع الأخير • Your final project is to make a three-dimensional model of DNA. • المشروع النهائي عبارة عن تصميم نموذج لل د ن أ ثلاثي الأبعاد Final project • You can work as a group of 3-4 student • per group (I want to see a group working • not an individual work) • Wikipedia, the free encyclopedia is • very useful site to start with and get • information (nucleotide, DNA, adenine, • thymine, cytosine, guanine , • complementary base pairing تستطيعون العمل على شكل مجموعات مكونة من 3 – 4 طلاب ، ( يرجى العمل كمجموعة ) . موقع الويكيبيديا يعتبر موقع مفيد لأخذ معلومات متعلقة بالموضوع وتستطيعون الاستعانة بهذه المفردات ( نيوكليوتيد ، د ن أ ، أدينين ، ثايمين ، سايتوسين ، جوانين ، قانون ربط القواعد ) . Project due date Is آخر موعد لتسليم المشروع -------------- 25

  29. Grade 10 Advanced Unit4:DNA&Protein synthesis Evaluation Rubric For your DNA model معايير تقييم نموذج ال د ن أ البيانات غير دقيقة أو غير موجودة بعض البيانات موجودة وصحيحة معظم البيانات موجودة وصحيحة جميع البيانات موجودة وصحيحة بعض من القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق جميع القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق معظم القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق قليل جدا من القواعد النيتروجينية مرتبطة بشكل صحيح ودقيق Participated in or actively listened to the class discussion. Somewhat paid attention during model construction. Played an active role in the class discussion of the activity. Paid attention during model construction. Listened somewhat to the discussion. Had trouble paying attention during model construction. No attention or participation in the discussion. Did not pay attention during model construction. الاستماع للمناقشة بإهتمام ، و إظهار بعض الاهتمام أثناء بناء النموذج . الاستماع للمناقشة بإهتمام وفاعلية ، و إظهار الاهتمام الشديد أثناء بناء النموذج . لم يظهروا أي اهتمام أو مشاركة أثناء المناقشة وبناء النموذج الاستماع للمناقشة الى حد ما ، واهتمام بسيط جدا أثناء بناء النموذج . 26

  30. Grade 10 Advanced Unit4:DNA&Protein synthesis References : Advanced Biology for you Internet 27

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer