edena
Uploaded by
11 SLIDES
1670 VUES
200LIKES

Exons and Introns

DESCRIPTION

Exons and Introns. Chesley Leslin. Steps in Production Proteins. exons: the sequences in the DNA molecule that code for the amino acid sequences of corresponding proteins. intron: the DNA sequence in a eukaryotic gene that is not translated into a protein. Transcription

1 / 11

Télécharger la présentation

Exons and Introns

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Exons and Introns Chesley Leslin

  2. Steps in Production Proteins • exons: the sequences in the DNA molecule that code for the amino acid sequences of corresponding proteins. • intron: the DNA sequence in a eukaryotic gene that is not translated into a protein. • Transcription • DNA – preRNA - mRNA • Translation • mRNA - Proteins

  3. What do we need for transcription? • DNA • In eukaryotes, the genome is divided into : • Non-coding areas... between genes. • Genes : Each gene is divided into several exons, separated by non coding sequences, • Introns (not coding) • Exons (coding) • Promoters, and regulation sequences. • RNA polymerases • RNA polymerases are enzymes that will synthesize different kinds of RNA. • Other factors • E.g. factor sigma: this stabilizes the polymerase at its specific site, to help polymerization to start. These other factors may be proteins or other kinds of molecules

  4. Translation mRNA UUUCUCAUUACUUAUUGUCGA now becomes Phe Leu Ile Thr Tyr Cys Arg Degenerate genetic code*….what?

  5. mRNA 1). Initiation Codon Anti –Condon 2). Elongation Amino Acid tRNA P 3). Termination M H I S F H

  6. RESEARCH……… We are interested in the evolution of the intron/exon structure of genes. Are the introns ancient structures, used to assemble the first genes four billion years ago? Or are they more recent acquisitions, used for exon shuffling in recently evolved proteins? Our work ranges from theoretical estimates for the size of the universe of exons to theoretical arguments that the introns are very old and that exons are related to folding subunits of proteins. We are studying the assembling of protein shapes from modular substructures.

  7. Protein Encoding Exon Containing Genes • Based on current GenBank release 133 • 128,000 proteins – lots of info • Have positions of Introns boundaries in proteins • Have structural data from PDB • Have ability to visualize structure • Can we correlate boundaries to structure? • Are boundaries conserved b/t species? • Were there ancient exons? • Alternative Splicing?

More Related