Download
genetic diversity variation n.
Skip this Video
Loading SlideShow in 5 Seconds..
Genetic Diversity (Variation) PowerPoint Presentation
Download Presentation
Genetic Diversity (Variation)

Genetic Diversity (Variation)

218 Vues Download Presentation
Télécharger la présentation

Genetic Diversity (Variation)

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Genetic Diversity (Variation) Genetic diversity is required for populations to adapt to environmental change.

  2. Importance of Genetic Diversity • Maintenance of GD is major focus of CG • It is hypothesized that GD is required for evolutionary change. • Low GD is related to reduced reproduction and survival (i.e. fitness). • Long Term (maintenance of adaptive evolutionary potential) • Short term (maintenance of reproductive fitness)

  3. Genetic Diversity • DNA level • Polymorphism, • heterozygosity, • allelic diversity

  4. How do we measure genetic variation in a natural population? • Knowing how much genetic variation a population carries requires that we know what fraction of the loci are polymorphic, how many alleles are present at each locus and what their frequencies are.

  5. How do we measure genetic variation? • Look directly at proteins or DNA Sequences • Allozymes: distinct form of enzyme encoded by different alleles at the same locus. • RFLP’s, AFLP’s, RFLP’s • DNA sequence • Microsatellites

  6. Tools • Gel electrophoresis • PCR • Automated DNA sequencing

  7. Determining Genotypes • Gel electrophoresis • DNA and proteins have charge • Apply electric current to samples and they migrate toward oppositely charged pole • Migrate according to size and mass • Differently sized alleles go different distances

  8. Gel electrophoresis

  9. Load Gel

  10. Run the Gel

  11. Take a Picture of the Gel

  12. Genetic Diversity in African Lions

  13. Genetic Diversity of Lions

  14. DNA based techniques Mitochondrial Genome Chloroplast Genome Nuclear Genome

  15. RFLP’s

  16. DNA methods • Sequence • AFLP’s • Microsatellites

  17. PCR – Purpose • Need multiple copies of the gene in order to sequence it • Primer extension reaction for amplification of specific nucleic acids in vitro

  18. PCR – Reaction Composition • tDNA • Sequence specific primers • dNTP’s • Taq polymerase • Buffer • Thermocycler

  19. PCR – How do we know it worked?

  20. DNASequencing How to get from this… TATCCGCATAATACAGATCCTCCCCACAACAAAAACCGACCTATTCCTTCCATTCATCAT TCTAGCCCTCTGAGGGGCAATTCTAGCCAATCTCACATGCCTACAACAGACAGACCTAAA ATCCCTAATCGCCTACTCCTCCATCAGCCACATAGGCCTAGTAGTAGCCGCAATTATTAT CCAAACCCCATGAGGCCTATCCGGAGCCATAGCTCTAATAATCGCACACGGATTTACCTC CTCAGCACTCTTCTGCCTAGCTAACACAACCTATGAACGAACACACACCCGAGTCCTAAT TCTTACACGAGGATTCCACAATATCCTACCCATAGCTACAACCTGATGACTAGTAACAAA CCTCATAAACATCGCCATCCCCCCCTCCATAAACTTCACCGGAGAGCTCCTAATTATATC CGCCCTATTTAACTGATGCCCAACAACAATCATCATACTAGGAATATCAATACTTATCAC CGCCTCTTACTCCCTACATATATTTCTGTCAACACAAATAGGGCCAACTCTACTAAACAA CCAAACAGAACCCACACACTCCCGAGAACACCTACTAATAACCCTCCACCTTGCCCCCCT ACTTATGATCTCCCTCAAACCAGAATTAGTCATCAGGAGTGTGCGTAATTTAAAGAAAAT ATCAAGCTGTGACCTTGAAAATAGATTAACCTCGCACACCGAGAGGTCCAGAAGACCTGC TAACTCTTCAATCTGGCGAA--CACACCAGCCCTCTCTTCTATCAAAGGAGAATAGTTA- CCCGCTGGTCTTAGGCACCACAACTCTTGGTGCAAAT To this!

  21. Components Ribonucleoside triphosphate Deoxynucleoside triphosphate Dideoxynucleoside triphosphate RNA DNA DDNA

  22. Microsatellites • http://helix.biology.mcmaster.ca/brent/brent.html • http://uwadmnweb.uwyo.edu/zoology/mcdonald/molmark/lectures/PopGen/PopGen6/PopGen6.html

  23. Microsatellites Tandem repeats of short sequences CACACACA High mutation rate(i.e. highly polymorphic) owing to replication slippage