Chapter 4 Molecular Cloning Methods
Chapter 4 Molecular Cloning Methods. Jay D. Hunt, Ph.D. Department of Biochemistry and Molecular Biology CSRB 4D1 568-4734 jhunt@lsuhsc.edu. I. Restriction Endonucleases. Restriction endonucleases
Chapter 4 Molecular Cloning Methods
E N D
Presentation Transcript
Chapter 4 Molecular Cloning Methods Jay D. Hunt, Ph.D. Department of Biochemistry and Molecular Biology CSRB 4D1 568-4734 jhunt@lsuhsc.edu
Restriction endonucleases • Restriction - Bacterial encoded restriction endonucleases restrict bacteriophages to only one host strain. • Endonuclease - Restriction endonucleases cleave nucleic acids in the middle.
Subclasses of restriction endonucleases: • Type I - Recognize specific sequences and cleave DNA at a nonspecific site > than 1,000 bp away • Type II - Recognize palindromic sequences and cleave within the palindrome • Type III - Recognize specific 5-7 bp sequences and cleave 24-27 bp down stream of the site. • Type II restriction endonucleases are the most useful class, as they recognize specific palindromic sequences in DNA and cleave the phospodiester bonds in the ribose backbone within the palindrome
A palindrome is anything that reads the same forwards and backwards: • Mom • Dad • Tarzan raised Desi Arnaz rat. • Able was I ere I saw Elba • Doc note I dissent, a fast never prevents a fatness; I diet on cod. • Do good? I? No! Evil anon I deliver. I maim nine more hero-men in Saginaw, sanitary sword a-tuck, Carol, I–lo–rack, cut a drowsy rat in Aswan. I gas nine more hero-men in Miami. Reviled, I (Nona) live on. I do, O God!
44 = 256 bp 46 = 4,096 bp 48 = 65,536 bp • In DNA, palindromes are defined as double stranded DNA that reads the same 5’ to 3’ • The EcoRI cutting site: • 5'-GAATTC-3' • 3'-CTTAAG-5' Types of recognition sites: 4 bp 6 bp 8 bp • The HindIII cutting site: • 5'-AAGCTT-3' • 3'-TTCGAA-5'
Type II restriction endonucleases cut only at specific palindromic sites; therefore, “sticky ends” result from DNA cleavage. Fragments of DNA cut with the same enzyme will hybridize to these sticky ends.
5’ overhang 5'AAGCTT3' 5'A3' 5'AGCTT3' Hin dIII 3'TTCGAA5' 3'TTCGA5' 3'A5' 5’ overhang 5'GAATTC3' 5'G3' 5'AATTC3' Eco RI 3'CTTAAG5' 3'CTTAA5' 3'G5' 5’ overhang 5'GGATCC3' 5'G3' 5'GATCC3' Bam HI 3'CCTAGG5' 3'CCTAG5 3'G5' Blunt end 5'GATATC3' 5'GAT3' 5'ATC3' Eco RV 3'CTATAG5' 3'CTA5' 3'TAG5' 3’ overhang 5'CTGCAG3' 5'CTGCA3' 5'G3' Pst I 3'GACGTC5' 3'G5' 3'ACGTC5' Always indicate 5’ and 3’ ends of BOTH strands.
Restriction Endonucleases Cloning
GAATTC GAATTC CTTAAG CTTAAG Digest with EcoRI G AATTC CTTAA G Hybridize G AATTC CTTAA G Ligation GAATTC CTTAAG Cloning
Figure 4.3 At least one unique restriction site A selectable marker Origin of replication
Figure 4.6 Multicloning site a-peptide of b-galactosidase
orip DNA fragment up to 5 KB can insert
lacZ is disrupted by insert w-peptide is carried in genetically modified bacterial strains. COOH-terminal portion No a-complementation occurs. White colonies a-complementation occurs. 5-bromo-4-chloro-3-indolyl-b-D- Galactopyranoside (X-gal) is metabolized resulting in blue colonies a-peptide of b-galactosidase is encoded by lacZ NH2-terminal portion
Figure 4.7b Addition of ligase would cause this to seal Phosphates are donated by the insert Ligation occurs Without phosphate group, ligation cannot occur
Figure 4.7a Note that the phosphate group is required for ligation to occur.
EcoRI EcoRI Kpn I Sal I/Acc I Hinc II Sma I/Xma I EcoRI Kpn I BamHI Xba I Sst I Pst I Sph I HindIII MCS pUC18 lacZ
EcoRI EcoRI Kpn I • 5'-G AATTC-3' • 3'-CTTAA G-5' • 5'-G C-3' • 3'-CTTAA CATGG-5' Digestion with EcoRI Digestion with EcoRI & Kpn I Sal I/Acc I Hinc II Sma I/Xma I BamHI HindIII EcoRI Kpn I Xba I Sph I Sst I Pst I
EcoRI EcoRI Kpn I Digest both insert and vector with EcoRI and Kpn I EcoRI Kpn I Sal I/Acc I Hinc II Sma I/Xma I BamHI HindIII EcoRI Kpn I Xba I Sph I Sst I Pst I
Figure 4.8 Required for lysogenic lifecycle Required for lytic lifecycle (progeny produced) 12 to 20 KB inserts
Genomic Library Construction BamHI BamHI BamHI BamHI BamHI BamHI BamHI BamHI BamHI BamHI BamHI cos sites ~4 KB 12-20 KB insert Too short, not viable
Sau3A, ~250 bp BamHI Sau3A -GGATCC- -GATC- -CCTAGG- -CATG- -G GATC- -CCTAG - -GGATC- -CCTAG-
Isolate pieces 12-20 KB in length Combine Package into phage heads Digest with BamHI Partial Digest with Sau3A
Figure 4.11 40 to 50 KB inserts
Restriction Endonucleases Cloning Probes to detect specific clones
GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG GGTGGCATGCCGATTCCAGCTAGTCAACCGTACTG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC Melt Probe GCCGATTCCAGCTAGTCAAGG
GCCGATTCCAGCTAGTCAAGG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC Low stringency hybridization GCCGATTCCAGCTAGTCAAGG Low stringency washing conditions High salt concentration (0.3 M NaCl) Low temperature (20 to 30°C) Low organic solvent concentrations
GCCGATTCCAGCTAGTCAAGG CCACCGTACGGCTAAGGTCGATCAGTTGGCATGAC CCACCGTACAAATAAGTTCAATCAGGGAACATGAC Low stringency hybridization High stringency washing conditions Low salt concentration (0.03 M NaCl) High temperature (65°C) High organic solvent concentrations GCCGATTCCAGCTAGTCAAGG GCCGATTCCAGCTAGTCAAGG
Restriction Endonucleases Cloning Probes to detect specific clones PCR
Denaturation (94°C) Annealing (37-65°C) Extension (72°C) Template Primers dNTPs + + First round complete
94°C 37-65°C 72°C Second round complete
1 2 4 8 16 32 64
30 rounds of PCR = 1,073,741,824 (1.07 X 109) copies 40 rounds of PCR = 1,099,511,628,000 (1.1 X 1012) copies Exponential Increase in Target DNA From 1 copy of template DNA
Restriction Endonucleases Cloning Probes to detect specific clones PCR cDNA cloning
Restriction Endonucleases Cloning Probes to detect specific clones PCR cDNA cloning Labeling DNA with nick translation
Restriction Endonucleases Cloning Probes to detect specific clones PCR cDNA cloning Labeling DNA with nick translation Cloning with Reverse Transcriptase-PCR