ernst
Uploaded by
4 SLIDES
243 VUES
50LIKES

DAPI

DESCRIPTION

600. 400. 200. 100. bp. 400. 200. 100. Ferri et al. Supplemental Figure 1. A. B. Isolation of the chromocenters. S. P. Nuclei + 2 mM TEA, 0.2 mM MgCl 2 , 0.2% Triton Sonication. kDa. CENP-A. 15. Centrifugation on 15% sucrose 200 g, 10 min. 40. Aurora B.

1 / 4

Télécharger la présentation

DAPI

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. 600 400 200 100 bp 400 200 100 Ferri et al. Supplemental Figure 1 A B Isolation of the chromocenters S P Nuclei + 2 mM TEA, 0.2 mM MgCl2, 0.2% Triton Sonication kDa CENP-A 15 Centrifugation on 15% sucrose 200 g, 10 min 40 Aurora B Elimination of unbroken nuclei 15 Survivin Centrifugation on 30% sucrose 2500 g, 20 min HDAC1 Elimination of nucleoli 60 120 Centrifugation on 30% sucrose 27000 g, 30 min Sir2 Pellet (P) = chromocenters Supernatant (S) = low density fraction C DAPI DNA merge S P D E S P S P bp - + - + minsat minsat

  2. Ferri et al. Supplemental Figure 2 IP SUP Marker 100bp Total DNA H3K9Me3 H3K9Me3 CENP-A CENP-A INPUT beads beads H3Ac H3Ac bp 500 bp minsat 300 100 2000 1500 500 600 majsat 300 400 100 300 200 100 rDNA 300 100

  3. counts counts PI PI Ferri et al. Supplemental Figure 3 AS NOC G0/G1: 33% S: 57% G2/M: 10% G0/G1: 2% S: 12% G2/M: 86% - + - + bp AS NOC 500 400 minsat 300 200 200 200 100 100 0 0 0 200 400 600 0 200 400 600 -actin

  4. input 1 2 3 4 5 MEL nuclear extracts Streptavidin beads RNA minsat In vitro transcribed RNA Biotinylated oligonucleotide Ferri et al. Supplemental Figure 4 1: RNA 2’OMe (1-27) 5’biot-GGAAACAUGAUAAAAACCACAGUGUAG-3’ 2: DNA (1-27) 5’biot-GGAAACATGATAAAAACCACAGTGTAG-3’ 3: DNA/lna (4-27) 5’-aACaTGaTAaAAaCCaCAgTGtAG-3’biot 4: DNA/lna (89-115) 5’-tGTgTAtATcAAtGAgTTaCAaTG-3’biot 5: DNA/lna (4-27) 5’biot-aACaTGaTAaAAaCCaCAgTGtAG-3’ murine minor satellites120 nt repeat unit consensus sequence : 5’GGAAACATGATAAAAACCACAGTGTAGAACATATTAGATGAGTGAGTTACACTGAAAAACACATTCGTTGGAAACGGGATTTGTAGAACAGTGTATATCAATGAGTTACAATGAGAAACAT-3’

More Related