evadne
Uploaded by
45 SLIDES
1194 VUES
600LIKES

DNA Profiling

DESCRIPTION

DNA Profiling. Dept of Biological Sciences California State University, Sacramento ballardr@csus.edu; Forensic Science Graduate Program University of California, Davis reballard@ucdavis.edu. Ruth E. Ballard, Ph.D . Applications and Methodology. Name: Ballard, Ruth Hair: Brown

1 / 45

Télécharger la présentation

DNA Profiling

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. DNA Profiling Dept of Biological Sciences California State University, Sacramento ballardr@csus.edu; Forensic Science Graduate Program University of California, Davis reballard@ucdavis.edu Ruth E. Ballard, Ph.D. Applications and Methodology

  2. Name: Ballard, Ruth Hair: Brown Eyes: Green Ht: 5’ 2” Wt: 105 Occupation: Professor and DNA/Biology Program Advisor Last Known Addresses: Dept of Biological Sciences California State University, Sacramento ballardr@csus.edu; Forensic Science Graduate Program University of California, Davis reballard@ucdavis.edu Wanted for: Impersonating a criminalist

  3. Why we need DNA markers

  4. Why we need DNA markers

  5. Outline • Short Tandem Repeat Markers • Definition • Applications • Generating a profile • CODIS • Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

  6. Definition • DNA profiling is a scientific technique that exploits genetic differences among people to distinguish them from one another

  7. Definition • Humans share 99.9% of their DNA • On average (for unrelated individuals) 1 in 1,000 base-pairs is different Sister chromatids Homologues

  8. Definition • Example: Human chromosome 1 • 4,220 genes (2%) • 98% non-coding “junk DNA” • 2.47 x 108 base-pairs • Average number of differences between unrelated homologues: 247,000 • Most differences are in non-coding fraction • DNA profiling exploits these differences across all chromosomes

  9. Outline • Short Tandem Repeat Markers • Definition • Applications • Generating a profile • CODIS • Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

  10. Applications • Solving Crimes (murder, sexual assaults, burglaries)

  11. Applications • Missing persons and unidentified remains • Skull found in a field in the Los Gatos hills is identified as belongingto missing Vallejo child, Xiana Fairchild, 14 months after her disappearance in Dec,1999

  12. Applications • Establishing Biological Relationships (child support, visitation, immigration, inheritance)

  13. Applications • Assigning twin status • Identical or fraternal?

  14. Applications • Identifying victims of man-made disasters • TWA Flight 800 • Exploded and crashed July 1996 in Atlantic Ocean off New York state

  15. Applications • Identifying victims of natural disasters • “Baby 81” claimed by 9 couples after tsunami in Southeast Asia • Identity confirmed as AbilassJevarajah and reunited with biological parents

  16. Outline • Short Tandem Repeat Markers • Definition • Applications • Generating a profile • CODIS • Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

  17. Short Tandem Repeat Markers • DNA profiling relies on short, tandemly repeated sequences of DNA (STRs) • Ubiquitous in the human genome • Short (for DNA profiling 4 bp) • e.g. gaca, ctat, ggca, etc. • Highly polymorphic (many alleles in the population) • “Alleles” defined by number of repeats present (e.g. 6,7,8,9,10,11,12,13,14,15, etc.) • No one allele present at much higher frequencies than others

  18. Short Tandem Repeat Markers • Example: D7S820 • Located on chromosome 7 • Repeated sequence: 5’-gata-3’ • Alleles observed in human population: 6,7,8,9,10,11,12,13,14,15,16 aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagttattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaactaacgatagatagatagatagatagatagatagatagatagatagatagatagatagatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttggtgcaattctgtcaatgaggataaatgtggaatcgttataattcttaagaatatatattccctctgagtttttgatacctcagattttaaggcc

  19. Short Tandem Repeat Markers • Level of discrimination rises with number of possible alleles

  20. Short Tandem Repeat Markers • Each person has only two alleles for each STR locus • Can be either heterozygous or homozygous (4,6) heterozygote (5,5) homozygote

  21. Short Tandem Repeat Markers • Allele frequency tables can be used to estimate genotype frequencies using Hardy Weinberg statistics Frequency (4,6) = 2 pq = 2 (0.001)(0.162) = 0.000324 (or 1 in 3,086 persons) Frequency (5,5) = p2 = (0.018)2 = 0.0262 (or 1 in 38 persons)

  22. Short Tandem Repeat Markers • The scientific community has chosen 13 core STR loci for DNA profiling • The amelogenin locus on the X and Y chromosomes is also targeted for sex typing

  23. Short Tandem Repeat Markers • The loci are genetically unlinked • Therefore, the inheritance of each STR is an independent event • This permits the product rule to be used when calculating the probability of an entire profile • The genotype frequency for each locus is calculated and then they are multiplied together to provide a random match probability (RMP) for the profile

  24. Short Tandem Repeat Markers • Random Match Probability (RMP) • The probability of randomly selecting an unrelated individual from the population who would have the same genetic profile as the person tested

  25. Short Tandem Repeat Markers • For my profile: • The probability of randomly selecting an unrelated individual from the population with the same genetic profile as myself is 1 in 11 quintillion!!

  26. Outline • Short Tandem Repeat Markers • Definition • Applications • Generating a profile • CODIS • Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

  27. Generating a Profile • DNA Profiling always starts with a biological sample • Cigarette butt a suspect smoked during questioning (cheek cells in suspect’s saliva) • A bloody knife found in a suspect’s car (blood cells - possibly from the victim) • A hair found in a ski mask left at the site of an armed robbery (hair root cells, possibly from the suspect) • Human femur bone found in a dumpster (bone cell DNA, possibly from the victim of a homicide) • A reference buccal swab from an alleged father for paternity testing

  28. Generating a Profile • Lyse open cells and extract DNA • PCA (organic method) • Spin columns • Robots (e.g. EZ1) • Quantify the amount of human DNA present • quantitative PCR (qPCR) • Amplify 13-15 STR loci in one PCR reaction • Multiplex • PCR primers are fluorescently-labeled • Amplicons differ by length depending on the number of repeats present • Separate and resolve amplicons by gel electrophoresis

  29. CHROMOSOME 7 received from mother carrying 9 repeats of GATA Primer B (reverse primer) Primer A (forward primer) CHROMOSOME 7 received from father carrying 12 repeats of GATA Amplicon from chromosome carrying 9 repeats Ampliconfrom chromosome carrying 12 repeats 12 base pairs

  30. (-) PCR sample loaded into capillary Samples run through capillary according to size As PCR products pass capillary window, a laser excites the fluorescent tag and thetag emits asignal detector The signal is sent to a computer for interpretation and analysis (+) Allele 14 at D7S820 Allele 14 at D7S820 Allele 11 at TPOX Allele 9 atTPOX Allele 7 atD7S820

  31. Blue Green Y axis = Amplitude of fluorescent signal Yellow Red X axis = Time since injection = size of amplicon

  32. Outline • Short Tandem Repeat Markers • Definition • Applications • Generating a profile • CODIS • Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

  33. CODIS • Established in 1994 • Director of FBI established a DNA Advisory Board • Defined and developed standards for DNA typing • Defined Indices for sample data banking • Fully operational in 1998 • Stores DNA profiles from in: • Convicted Offenders Index • Forensic Index • Missing persons Index • Missing persons reference Index • Arrestee Index • Allows law enforcement agencies to share information across all 50 states

  34. Reference sample from victim DNA profile of victim BIOLOGICAL EVIDENCE AT CRIME SCENE Match? DNA Profile from evidence Match? DNA Profile from suspect(s) If suspect(s) eliminated (or no suspects) Suspect(s)

  35. Search Convicted Offender or Arrestee Indexes in CODIS NO “HIT” “HIT” Repeat search every 7 days Prosecute

  36. CODIS • National (2008) • Convicted Offender profiles: 7,940,321 • Forensic profiles: 306,028 • “Hits”: 107,600 • California (2008) • Convicted Offender profiles: 1,251,307 • Forensic profiles: 25,323 • “Hits”: 12, 412

  37. Outline • Short Tandem Repeat Markers • Definition • Applications • Generating a profile • CODIS • Cold Case Study: Solving the abduction, rape, and murder of Penny Parker

  38. Cold Case Study • May 1977: Penny Parker, 15, disappeared while out collecting money for her Sacramento Bee paper route • Found dead three days later,stabbed and sexually assaulted • At the time, the analysis of biological evidence was in its infancy • Suspect identified but insufficient evidence to charge

  39. Cold Case Study • DNA typing methods introduced in 1986 and rapidly improved in 1990’s • Parker case reopened in 2001 • Semen stain found on panties and DNA profile obtained • Profile entered into the FBI’s national CODIS database; no match

  40. Cold Case Study • December 2002, samples submitted from the ex-wife and biological daughter of suspect Don Jennings. • Relationship DNA profiling showed that it was 10,000 times more likely that Mr. Jennings was the source of the semen on Penny Parker’s panties than a random, unrelated man • Judge ordered Mr. Jennings to provide DNA reference sample for comparison to DNA from semen stain on panties

  41. Cold Case Study • January 2003, Sacramento Police Department detectives traveled to Arkansas to obtain a reference sample from Mr. Jennings. • Sample profiled and found to match the profile of the semen donor. • Mr. Jennings committed suicide in February 2003, when officers returned to Arkansas and attempted to arrest him for the rape/homicide of Parker. • Demonstrates power of biological evidence to solve crimes, even “cold” ones

  42. Additional Information • American Academy of Forensic Sciences http://www.aafs.org/ • U.S. Bureau of Labor Statistics http://www.aafs.org/ • California Association of Criminalists http://www.cacnews.org/ • STRbase (http://www.cstl.nist.gov/strbase/) • U.C. Davis Forensic Science Graduate Program http://forensicscience.ucdavis.edu/

More Related