hashim-pierce
Uploaded by
61 SLIDES
1037 VUES
680LIKES

DNA Profiling

DESCRIPTION

DNA Profiling. Forensic Science Florio. Learning Sequence. History, DNA Structure, Chromosomes Sources of DNA DNA and the Crime Scene Methods of DNA Typing Process of DNA Typing CODIS. Brief History. 1980 - American researchers discovered non-coding regions of DNA

1 / 61

Download Presentation
Télécharger la présentation

DNA Profiling

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Profiling Forensic Science Florio

  2. Learning Sequence • History, DNA Structure, Chromosomes • Sources of DNA • DNA and the Crime Scene • Methods of DNA Typing • Process of DNA Typing • CODIS

  3. Brief History • 1980 - American researchers discovered non-coding regions of DNA • 1984 - Professor Alec Jeffreys developed the process of DNA profiling • 1987 - First conviction based on DNA evidence

  4. DNA • What is DNA? • How does DNA work? • Why test DNA? • Where can DNA be located? • Biological tissues? • Evidence collection? • How can DNA be used to potentially identify an individual? • Can DNA evidence be destroyed or contaminated? • To what extent is DNA profiling accurate?

  5. What is DNA? • Double stranded helix • Polymer • Nucleus • Mitochondria • Sugar, phosphate and 4 types of bases (A,T,C,G) = NUCLEOTIDE -Hydrogen bonds Skin cell Skin cell DNA

  6. What is DNA?

  7. What is DNA?Chromosomes From mom From dad 22 pairs total (traits) + X,Y or XX Male Female

  8. Important Definitions • Genes – DNA sequences that have instructions that determine our inherited traits • Allele – one of two or more alternative forms of a gene (1 from mom, 1 from dad) • Polymorphism – differences in DNA sequences; vary in length, bases, and number of repeats

  9. Review of DNA • What does DNA do? • Make proteins! • DNA  mRNA  Proteins • How is it copied during mitosis? • DNA Replication!

  10. Why Test DNA?Human Identity Testing • Forensic cases -- matching suspect with evidence • Paternity testing -- identifying father • Historical investigations • Missing persons investigations • Mass disasters -- putting pieces back together • Military DNA “dog tag” • Convicted felon DNA databases

  11. Where can DNA be located?(Biological tissue) • Blood • Semen • Saliva • Urine • Hair • Teeth • Bone • Tissue

  12. DNA and the Crime Scene You could have a scene that looks like this…

  13. DNA and the Crime Scene Or a scene that looks like this…

  14. What are some sources of DNA at this scene?

  15. Sources of DNA Evidence

  16. DNA and the Crime Scene • The Method of DNA Typing depends on… • How much DNA you have (# of cells) • Condition of the DNA • Nature of the crime

  17. DNA and The Crime Scene Collection protocols • Bio evidence photographed up close and at multiple angles • Position in the scene is important to note! Why? • Handling – minimal contact! • Wear gloves! Change frequently!

  18. DNA and The Crime Scene Packaging • All clothing packaged separately in breathable bags or boxes • Dried blood – remove with moisten cotton swab • Acquire a substrate control – unstained portion of surface on which bio material has been deposited – compare to stained area

  19. Packaging DNA

  20. DNA and The Crime Scene Packaging • All swabs and evidence must be air dried! • Refrigerated • Obtain buccal swabs from suspects

  21. Polymorphism critical to distinguish individuals • A. • GATCTAGCTAGCTACCTAGCTATCCTAGC • GATCTAGCTTGCTACGTAG-TATCCTAGC • egSingle Nucleotide Polymorphism • B. • GCTGCTGCTGCTGCTGCTGCTGCTGCT • GCTGCTGCT---------------GCT • egRepeat unit (including Short Tandem Repeats - STRs) • Individuals differ on average by 0.1% at the DNA level = 3.4 million base pairs

  22. What patterns do we observe in our genomes? AGCTGACTGACTTTCAGCTAGC TACACGTACGCTAGCTAGCTAG ACTAGCATGCATGCCATGCCAT GCCATGCCATGCCATGCCATGC CATGCCATGCCCATGCTAACTT GATCGGACCGCGCGCTAGCTAG CTAGCTACACTGCTAGCCCGAT CGCTAGCCTAGCAGCTGGT

  23. What is DNA Profiling? • DNA PROFILING • A process or technique of analysis revealing unique patterns of an individual’s DNA involving non-coding regions

  24. Not enough DNA? PCR is the answer! Polymerase chain reaction (PCR) • Small quantities of DNA/broken pieces of DNA can be copied • Use enzyme DNA Polymerase 1 DNA molecule 1 million DNA molecules Sample size

  25. PCR • What part of the DNA is amplified? Short repeated segments (STRs) – region of DNA molecule that contains short segments of repeating bases (3-7 base pairs)

  26. PCR Purpose – Quickly make many copies of a region of a DNA molecule Method – Multiple rounds of DNA replication using a Thermal Cycler * each cycle doubles amount of DNA until millions of copies are produced

  27. Methods of Analysis • Restriction Fragment Length Polymorphism (RFLP) • Short Tandem Repeat (STR) • * Y-STR • Mitochondrial DNA

  28. (Restriction Fragment Length Polymorphisms - RFLP) • 9-80 bases in length • Non-coding regions • Pieces cut by restriction enzymes • Number of repeats varies from one person to the next

  29. STRs • Short Tandem Repeat (STR) • Repeats of 2-5 or 3-7 bases (dependent on source) • Shorter than samples needed for RFLP • High degree of polymorphism • Greater variation in # of repeats • More preferred method of analysis • Larger the strand, harder it is to separate sequences

  30. What makes Short Tandem Repeats(STR) good markers? • Repetitive sequences on all human chromosomes • High degree of genetic variability • Sensitive and rapid detection • Several loci can be combined in a single test

  31. Identifying an individual? The Big Picture Collect Tissue Sample >1000 cells >20 cells PCR Analysis PCR Analysis (STR) RFLP

  32. Over 10 Markers Can Be Copied at Once Sensitivities to levels less than 1 ng of DNA Ability to Handle Mixtures and Degraded Samples Different Fluorescent Dyes Used to Distinguish STR Alleles with Overlapping Size Ranges Multiplex PCR

  33. Locates STRs on the Y chromosome Look for about 17 STRs Helpful with sexual assaults or when more than 1 male involved Vaginal swabs Saliva Blood Y STR Analysis

  34. Mitochondrial DNA Analysis • Inherited from mother • Single mito contains many loops of DNA • Each cell contains 100-1000 mito • Useful when nDNA is degraded

  35. Mitochondrial DNA Analysis • Charred remains • Old remains • Hair • Mass Disasters • Historic Investigations • Need living maternal relative for a match

  36. Mitochondrial DNA Analysis • Constructed in circular loop • Single mito contains many loops of DNA • Each cell contains 100-1000 mito • Useful when nDNA is degraded

  37. The Process of DNA Analysis • Extraction • Amplification (if needed) • Enzyme Digestion (restriction enzymes) • Gel or Capillary Electrophoresis

  38. STAGES INVOLVED • Cells broken down to release DNA • DNA strands cut into fragments • Fragments separated • Pattern of fragments analyzed

  39. DNA Extraction

  40. Enzyme Digestion

  41. Enzyme Digestion • Restriction enzymes added to sample DNA • DNA cleaved at specific sites • Due to varying number of repeated segments at these sites, DNA will be cut in varying lengths

  42. Identifying an individual? • Techniques? • RFLP analysis • STR analysis We need more DNA!!!!!!! Polymerase chain reaction (PCR)

  43. DNA ProfilingRFLP Extract DNA sample Digest DNA sample Collect DNA Gel electrophoresis Label and analyze Separate fragments by (via charge) molecular weight

  44. DNA ProfilingPCR/STRs Extract DNA sample Collect DNA PCR amplification Capillary electrophoresis

  45. Gel Electrophoresis • Fragments separated by • length • DNA (negatively • charged) • Moves towards +ve • terminal • Shorter fragments move faster

  46. Gel Transfer • DNA split into single strands using alkaline solution • DNA fragments transferred from gel to filter paper or nylon membrane. (This is called Southern blotting) • Gel, with filter paper attached, is removed & separated

  47. DNA Probes Radioactive probe in solution binds to DNA Revealing a pattern of bands X-ray film

  48. How Do DNA Probes Work?

  49. Capillary Electrophoresis • Used with STR analysis • Quick and can be automated • Carried out in thin, glass capillary column • 2 reservoirs hold buffers connected to high voltage • Process • DNA injected into capillary tube • STR fragments move b/c of electrical potential • DNA segments move through DETECTOR • Data displayed on ELECTROPHEROGRAM

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer