felicia-pittman
Uploaded by
1 SLIDES
258 VUES
10LIKES

PAR-CLIP Basic Analysis Outline

DESCRIPTION

PAR-CLIP Basic Analysis Outline. FMR.fastq. # Convert from fastq to fasta fastq_to_fasta -v - i FMR.fastq -o FMR.fasta ;. FASTQ-to-FASTA. # Remove adapters from reads fastx_clipper -v -a TCGTATGCCGTCTTCTGCTTG -l 13 - i FMR.fa –o FMR.clipped ;. FASTQ/A Clipper.

1 / 1

Télécharger la présentation

PAR-CLIP Basic Analysis Outline

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PAR-CLIP Basic Analysis Outline FMR.fastq • # Convert from fastq to fasta • fastq_to_fasta -v -iFMR.fastq -o FMR.fasta; FASTQ-to-FASTA • # Remove adapters from reads • fastx_clipper -v -a TCGTATGCCGTCTTCTGCTTG -l 13 -iFMR.fa–o FMR.clipped; FASTQ/A Clipper # Collapse redundant reads to speed up alignment (can also use fastx_collapser) perlcollapseFA.plFMR.clipped >FMR.collapsed; FASTQ/A Collapser #Map reads to the genome Bowtie bowtie/base/hg19 -v 2 -m 10 --all --best --strata -f FMR.collapsed > FMR.bowtie; Bowtie #Identify binding sites based on T->C conversion density See “FMR.ini” for detailed parameters PARalyzer FMR.clusters = “binding sites” (note there are other PARalyzer output) #Annotate reads binding sites See FMR.yaml for tie-break priorities (higher number = higher priority) Annotator #Identify putative RREs enriched for T->C conversions See “run_cERMIT_FMR” in “FMR1_iso1_wt_cERMIT.zip” for detailed parameters cERMIT

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer