feng
Uploaded by
61 SLIDES
992 VUES
650LIKES

DNA and RNA

DESCRIPTION

DNA and RNA. DNA. Double Stranded Double Helix Nitrogen Bases Adenine and Thymine Guanine and Cytosine Deoxyribose sugar Phosphate groups.

1 / 61

Télécharger la présentation

DNA and RNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA and RNA

  2. DNA • Double Stranded • Double Helix • Nitrogen Bases • Adenine and Thymine • Guanine and Cytosine • Deoxyribose sugar • Phosphate groups • http://images.google.com/imgres?imgurl=http://www.x1.ltd.uk/brooks_website/B_Site_stuff/3Dimages/dna.jpg&imgrefurl=http://www.x1.ltd.uk/brooks_website/B_Site_stuff/3D_stuff.html&h=1000&w=1200&sz=119&tbnid=3U9kaW2lmA0J:&tbnh=125&tbnw=150&start=5&prev=/images%3Fq%3DDNA%26hl%3Den%26lr%3D%26sa%3DG

  3. Cytosine Thymine Uracil Single Carbon Ring Capable of forming Hydrogen bonds Guanine Adenine Double Carbon Ring Capable of Forming Hydrogen bonds Pyrimidines VS. Purines

  4. Structure of DNA • Discovered by Francis Crick and James Watson in 1953, but not without the pictures provided from Rosalind Franklin. • Sides are formed by • Sugar and phosphate groups. • Rungs are formed by nitrogen bases • Adenine and Thymine (2 hydrogen bonds) • Guanine and Cytosine (3 hydrogen bonds)

  5. Measurements of DNA • Entire DNA is 2 nm wide • One full turn is equal to 3.4 nm • 0.34 nm between pairs (rungs) http://genetics.gsk.com/overview.htm

  6. The processes of DNA • Replication • Done only during cell division • Purpose: to transfer DNA from one cell to the next • Protein synthesis • Transcription • Translation

  7. Purpose of DNA replication • To copy the genetic material so that the new daughter cell will have a copy of the genetic material.

  8. Process of Replication

  9. Process of Replication • 1. DNA helicase unzips the DNA (an enzyme (protein)) • Breaks the hydrogen bonds between bases • Free floating nucleotides attach to where they belong on the two separated strands • DNA polymerase connects the sugars and phosphates together. (proofreads as well)

  10. Process of Replication

  11. Product of Replication • A copy of the original DNA (the entire chromosome) • Each chromosome is copied this way all 23 pairs. • Each new strand of the double stranded DNA has one original and one new strand • Called semi-conservative replication

  12. Practice • Lets practice replicating DNA. • ATTGCTACGGGACCTAAGTCCA ?What does the other strand of DNA look like? TAACGATGCCCTGGATTCAGGT

  13. Errors • DNA polymerase acts to read forward what bases are needed and reads backwards to ensure that no mistakes are made. • If mistakes are made, but not corrected in the sex cells, they will be passed on to their offspring.

  14. Protein Synthesis Two major processes Transcription Translation RNA is utilized to “copy” the DNA

  15. RNA • RNA is single stranded • Contains Uracil in place of Thymine • Sugar is ribose • RNA exists in three forms • Messenger RNA (mRNA) • Transfer RNA (tRNA) • Ribosomal RNA (rRNA)

  16. Functions of different RNA’s • Messenger RNA is used to transcribe the sequence of DNA bases • Transfer RNA is used to bring an amino acid to the mRNA • r RNA is a part of the ribosome (we won’t talk about it anymore)

  17. Transcription • Purpose: use DNA strand as a template to create a “working” mRNA copy of the DNA code • Steps • DNA is uncoiled and unzipped (RNA polymerase does both functions) • Nonsense strand used as a template to create an RNA copy of the DNA code • After copying, the DNA is rezipped and recoiled.

  18. Transcription • The RNA strand contains introns and exons (lengths of DNA code) • Introns are “removed” from the mRNA • Exons are “joined together” to form the protein code. • Spliced mRNA leaves the nucleus

  19. RNA splicing

  20. Translation • mRNA binds to a ribosome. Ribosome has a binding site for a complementary tRNA • AUG is always the start codon. • Complementary tRNA brings an amino acid • The frame is then shifted and another codon is exposed. The anticodon on another tRNA pairs with the codon. • Each amino acid is joined to the previous amino acid using a peptide bond • All polypeptide chains are completed with a stop codon.

  21. tRNA

  22. Ribosome Polypeptide mRNA

  23. Practice • Practice transcribing mRNA from DNA. Here is the DNA sequence • TTACGCAGTTACCGTACCGTTCGGAA • AATGCGTCAATGGCATGGCAAGCCTT • The first code is the template (nonsense) strand AAUGCGUCAAUGGCAUGGCAAGCCUU

  24. Translation (making polypeptides) • Remember polypeptides are long chains of amino acids • It usually requires several polypeptides to make a protein. • Sometimes several genes are used to make a protein.

  25. We are not the only ones! • Humans, dogs, cats, animals (eukaryotes-with a nucleus) are not the only ones! • Bacteria as well copy their DNA, go through transcription and translation. • Bacteria can be used to mass produce proteins! • Insulin for example

  26. Practice ATGCTATCTGGA TACGATAGACCT • DNA gene: • mRNA: • Polypeptide sequence: AUGCUAUCUGGA Methionine-Leucine-Serine-Glycine

  27. Universal Codes • Much of the DNA sequence for humans are present in other mammals! • Very advantageous for medicine research! • Mitochondrial DNA codes are not universal.

  28. Practice ATGTATTTTCTTTAA TACATAAAAGAAATT • DNA gene: • mRNA: • Polypeptide sequence: AUGUAUUUUCUUUAA Methionine-Tyrosine-Phenylalanine-Leucine-Stop

  29. Practice GCGACTCCCTCATGGTGA CGCTGAGGGAGTACCACT • DNA gene: • mRNA: • Polypeptide sequence: GCGACUCCCUCAUGGUGA Alanine-Threonine-Proline-Serine-Tryptophan-Stop

  30. Gene Expression • Gene expression • process by which inheritable information from a gene, such as the DNA sequence, is made into a functional gene product, such as protein or RNA.

  31. Creating RNA – • Non-protein coding genes (e.g. rRNA genes, tRNA genes) are transcribed, but not translated into protein.

  32. Gene Expression Chapter 11

  33. Objectives (p 217) • Explain why cells regulate gene expression • Discuss the role of the operons in prokaryotic gene expression • Determine how repressor proteins and inducers affect transcription in prokaryotes • Describe the structure of a eukaryotic gene • Compare the two ways gene expression is controlled in eukaryotes

  34. Vocabulary (217) • Gene expression • Genome • Structural protein • Operator • Operon • Lac operon • Repressor protein • Regulator gene • Intron • Exon • Pre-mRNA

  35. Role of Gene Expression • Gene expression • Turning on of a gene • Two major steps – transcription and translation • It is THE SAME as saying protein synthesis • Not all genes are transcribed • Proteins have many roles • Structure, enzyme, hormone, messenger

  36. Genome • Complete genetic material in an organism • Regulation of genes • Expression is regulated  cells control what part of the genome is produced, when, and how much

  37. Gene Expression - Prokaryotes • Both transcription and translation occur in the cytoplasm. • Single chromosome with “groups” of proteins • Classic example of gene regulation • Jacob and Monod (1960s) • Worked with the genes that control metabolism (catabolism) of lactose in E.coli • WHY: Lactose intolerance!

  38. The lac operon (218) • Operon • A series of genes that code for specific products (enzymes in this case) and the regulatory elements that control these genes • The lac operon • Controls lactose breakdown to glucose/galactose • Is induced (turned on) by the presence of lactose

  39. The lac operon consists of • Structural genes • Genes that code for polypeptides (3 in the lac operon) • Promotor • DNA segment recognized by RNA polymerase • Operator • DNA segment that controls access to the DNA. Sort of an “on/off” switch

  40. The Operon “switch” (pg 218) • Based on presence of lactose • Lactose absent (diagram 11-1) • Repressor protein binds (folds around) to the operator • RP made at a gene located some distance from the lac operon • Blocks binding of RNA polymerase to the promotor • Lactose present (diagram 11-2) • Lactose binds to repressor protein • Repressor detaches from operator • RNA polymerase makes all three proteins (transcribes all the structural proteins in that operon. • Lactose decreases  repressor binds • “negative feedback mechanism”

  41. Gene expression - Eukaryotes • Different than prokaryotes • Larger genome • More than one chromosome • More complicated than in prokaryotes • Specialized (differentiated) cells • Some proteins produced, some not

  42. Control of a Eukaryotic Gene • Lots of control at the chromosome level • Coiling around the histones controls transcription • Some parts of the chromosome NEVER uncoil after meiosis/mitosis! • RNA polymerase still binds to promotor • Two types of segments within the gene exist • Introns, Exons • Benefit of introns not fully understood

  43. Control at the start of transcription (222) • Transcription factors (Tf) • Proteins that help RNA polymerase to “find the starting place” • Can be many Tf or just one • Transcription factors can bind to enhancers • Result: activate transcription factors bound to promotors (see figure 11-4)

  44. Eucaryotes “after transcription” (221) • Pre mRNA  introns cut out  exons joined  working mRNA copy • Introns are recycled • Splicing accomplished using • Spliceosomes (RNA/protein complex) OR • Ribozymes(RNA molecules acting as enzymes)

  45. Gene Expression in Development and Cell Division The control of gene expression plays an important role in the growth of eukaryotes as different cells become specialized to perform different tasks. When the expression of genes is altered – by mutations for example – abnormalities and even cancer can result.

  46. Objectives • Summarize the role of gene expression in an organism’s development • Describe the influence of homeotic genes in eukaryotic development • State the role of the homeobox in eukaryotic development • Summarize the effects of mutations causing cancer • Compare the characteristics of cancer cells with those of normal cells.

  47. Cell differentiation Homeotic genes Homeobox Proto-oncogene Oncogene Tumor Cancer Tumor-suppressor gene Metastasis Carcinogin Carcinoma Sarcoma Lymphoma Leukemia Vocabulary

  48. Gene Expression in Development • Every cell in an organisms contains all the genes in the zygote • This means that EVERY cell gets all genes • BUT… only a few genes are “on” at the beginning of development

More Related