finley
PRESENTED BY
22 SLIDES
969 VUES
300 LIKES

High Throughput Sequencing

DESCRIPTION

High Throughput Sequencing. Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520. First Generation. Sanger Sequencing: sequencing and detection 2 different steps: 384 * 1kb / 3 hours. Second Generation. Massively parallel sequencing by synthesis

1 / 22

Télécharger la présentation

High Throughput Sequencing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. High Throughput Sequencing Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520

  2. First Generation • Sanger Sequencing: sequencing and detection 2 different steps: 384 * 1kb / 3 hours

  3. Second Generation • Massively parallel sequencing by synthesis • Many different technologies: Illumina, 454, SOLiD, Helicos, etc • Illumina: HiSeq, MiSeq, NextSeq • 1-16 samples • 25M-4B reads • 30-300bp • 1-8 days • 15GB-1TB output • Moving targets

  4. Illumina Library Prep

  5. Illumina Cluster Generation • Amplify sequenced fragments in place on the flow cell • Can sequence from both the pink and purple adapters (Paired-end seq) • Can multiplex many samples / lane

  6. Illumina Sequencing

  7. Third Generation • Single molecule sequencing: no amp • Fewer but much longer reads • Good for genome sequencing, but not for read count applications http://www.youtube.com/watch?v=v8p4ph2MAvI

  8. High Throughput Sequencing • Big (data), fast (speed), cheap (cost), flexible (applications) • Bioinformatic analyses become bottleneck

  9. High Throughput Sequencing Data Analysis

  10. FASTQ File • Format • Sequence ID, sequence • Quality ID, quality score • Quality score using ASCII (higher -> better) @HWI-EAS305:1:1:1:991#0/1 GCTGGAGGTTCAGGCTGGCCGGATTTAAACGTAT +HWI-EAS305:1:1:1:991#0/1 MVXUWVRKTWWULRQQMMWWBBBBBBBBBBBBBB @HWI-EAS305:1:1:1:201#0/1 AAGACAAAGATGTGCTTTCTAAATCTGCACTAAT +HWI-EAS305:1:1:1:201#0/1 PXX[[[[XTXYXTTWYYY[XXWWW[TMTVXWBBB

  11. FASTQC: Sequencing Quality

  12. Read Mapping • Mapping hundreds of millions of reads back to the reference genome is CPU and RAM intensive and slow • Read quality decreases with length (small single nucleotide mismatches or indels) • Most mappers allow ~2 mismatches within first 30bp (4 ^ 28 could still uniquely identify most 30bp sequences in a 3GB genome), slower when allowing indels • Mapping output: SAM (BAM) or BED

  13. Spaced seed alignment • Tags and tag-sized pieces of reference are cut into small “seeds.” • Pairs of spaced seeds are stored in an index. • Look up spaced seeds for each tag. • For each “hit,” confirm the remaining positions. • Report results to the user.

  14. Burrows-Wheeler • Store entire reference genome. • Align tag base by base from the end. • When tag is traversed, all active locations are reported. • If no match is found, then back up and try a substitution. Trapnell & Salzberg, Nat Biotech 2009

  15. Burrows-Wheeler Transform • Reversible permutation used originally in compression • Once BWT(T) is built, all else shown here is discarded • Matrix will be shown for illustration only T BWT(T) Encoding for compression gc$ac 1111001 Burrows Wheeler Matrix Last column Burrows M, Wheeler DJ: A block sorting lossless data compression algorithm. Digital Equipment Corporation, Palo Alto, CA 1994, Technical Report 124; 1994 Slides from Ben Langmead

  16. Burrows-Wheeler Transform • Property that makes BWT(T) reversible is “LF Mapping” • ith occurrence of a character in Last column is same text occurrence as the ith occurrence in Firstcolumn Rank: 2 BWT(T) T Rank: 2 Burrows Wheeler Matrix Slides from Ben Langmead

  17. Burrows-Wheeler Transform • To recreate T from BWT(T), repeatedly apply rule: T = BWT[ LF(i) ] + T; i = LF(i) • Where LF(i) maps row i to row whose first character corresponds to i’s last per LF Mapping FinalT Slides from Ben Langmead

  18. Exact Matching with FM Index • To match Q in T using BWT(T), repeatedly apply rule: top =LF(top, qc); bot = LF(bot, qc) • Whereqc is the next character in Q (right-to-left) and LF(i, qc) maps row i to the row whose first character corresponds to i’s last character as if it were qc Slides from Ben Langmead

  19. Exact Matching with FM Index • In progressive rounds, top & bot delimit the range of rows beginning with progressively longer suffixes of Q (from right to left) • If range becomes empty the query suffix (and therefore the query) does not occur in the text • If no match, instead of giving up, try to “backtrack” to a previous position and try a different base (mismatch, much slower) Slides from Ben Langmead

  20. Seq Files @HWI-EAS305:1:1:1:991#0/1 GCTGGAGGTTCAGGCTGGCCGGATTTAAACGTAT +HWI-EAS305:1:1:1:991#0/1 MVXUWVRKTWWULRQQMMWWBBBBBBBBBBBBBB @HWI-EAS305:1:1:1:201#0/1 AAGACAAAGATGTGCTTTCTAAATCTGCACTAAT +HWI-EAS305:1:1:1:201#0/1 PXX[[[[XTXYXTTWYYY[XXWWW[TMTVXWBBB HWUSI-EAS366_0112:6:1:1298:18828#0/1    16      chr9    98116600        255     38M     *       0       0       TACAATATGTCTTTATTTGAGATATGGATTTTAGGCCG  Y\]bc^dab\[_UU`^`LbTUT\ccLbbYaY`cWLYW^  XA:i:1  MD:Z:3C30T3     NM:i:2 HWUSI-EAS366_0112:6:1:1257:18819#0/1    4       *       0       0       *       *       0       0       AGACCACATGAAGCTCAAGAAGAAGGAAGACAAAAGTG  ece^dddT\cT^c`a`ccdK\c^^__]Yb\_cKS^_W\  XM:i:1 HWUSI-EAS366_0112:6:1:1315:19529#0/1    16      chr9    102610263       255     38M     *       0       0       GCACTCAAGGGTACAGGAAAAGGGTCAGAAGTGTGGCC  ^c_Yc\Lcb`bbYdTa\dd\`dda`cdd\Y\ddd^cT`  XA:i:0  MD:Z:38 NM:i:0 chr1 123450 123500 + chr5 28374615 28374615 - • Raw FASTQ • Sequence ID, sequence • Quality ID, quality score • Mapped SAM • Map: 0 OK, 4 unmapped, 16 mapped reverse strand • XA (mapper-specific) • MD: mismatch info • NM: number of mismatch • Mapped BED • Chr, start, end, strand http://samtools.sourceforge.net/SAM1.pdf

  21. Mapping Statistics Terms • Mappable locations: reads that can find match to A location in the genome • Uniquely mapped reads: reads that can find match to A SINGLE location in the genome • Repeat sequences in the genome, length-dependent • Uniquely mapped locations: number of unique locations hit by uniquely mapped reads • Redundancy: potential PCR amplification bias

  22. Summary • Sequencing technologies • 1st, 2nd, 3rd generation • Sequence quality assessment • FASTQC • Read mapping • Spaced seed • BWA: Borrows Wheeler transformation, LF mapping

More Related