virgo
Uploaded by
67 SLIDES
1344 VUES
700LIKES

High Throughput DNA Sequencing

DESCRIPTION

High Throughput DNA Sequencing. 30,000. Shotgun Sequencing. Isolate Chromosome. ShearDNA into Fragments. Clone into Seq. Vectors. Sequence. Principles of DNA Sequencing. Primer. DNA fragment. Amp. PBR322. Tet. Ori. Denature with heat to produce ssDNA. Klenow + ddN + dN

1 / 67

Télécharger la présentation

High Throughput DNA Sequencing

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. High Throughput DNA Sequencing

  2. 30,000

  3. Shotgun Sequencing Isolate Chromosome ShearDNA into Fragments Clone into Seq. Vectors Sequence

  4. Principles of DNA Sequencing Primer DNA fragment Amp PBR322 Tet Ori Denature with heat to produce ssDNA Klenow + ddN + dN + primers

  5. The Secret to Sanger Sequencing

  6. dATP dCTP dGTP dTTP ddCTP dATP dCTP dGTP dTTP ddTTP dATP dCTP dGTP dTTP ddATP dATP dCTP dGTP dTTP ddCTP Principles of DNA Sequencing 3’ Template G C A T G C 5’ 5’ Primer GddC GCddA GCAddT ddG GCATGddC GCATddG

  7. Principles of DNA Sequencing G T _ _ C A G C A T G C + +

  8. Capillary Electrophoresis Separation by Electro-osmotic Flow

  9. Multiplexed CE with Fluorescent detection ABI 3700 96x700 bases

  10. Shotgun Sequencing Assembled Sequence Sequence Chromatogram Send to Computer

  11. Shotgun Sequencing • Very efficient process for small-scale (~10 kb) sequencing (preferred method) • First applied to whole genome sequencing in 1995 (H. influenzae) • Now standard for all prokaryotic genome sequencing projects • Successfully applied to D. melanogaster • Moderately successful for H. sapiens

  12. The Finished Product GATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACAGATTACAGATTACAGATTACAGA TTACAGATTACAGATTACAGATTACAGATTACAGAT TACAGATTAGAGATTACAGATTACAGATTACAGATT ACAGATTACAGATTACAGATTACAGATTACAGATTA CAGATTACAGATTACAGATTACAGATTACAGATTAC AGATTACAGATTACAGATTACAGATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACAGATTACAGATTACAGATTACAGA TTACAGATTACAGATTACAGATTACAGATTACAGAT

  13. Sequencing Successes T7 bacteriophage completed in 1983 39,937 bp, 59 coded proteins Escherichia coli completed in 1998 4,639,221 bp, 4293 ORFs Sacchoromyces cerevisae completed in 1996 12,069,252 bp, 5800 genes

  14. Sequencing Successes Caenorhabditis elegans completed in 1998 95,078,296 bp, 19,099 genes Drosophila melanogaster completed in 2000 116,117,226 bp, 13,601 genes Homo sapiens 1st draft completed in 2001 3,160,079,000 bp, 31,780 genes

  15. Scoring Matrices • An empirical model of evolution, biology and chemistry all wrapped up in a 20 X 20 table of integers • Structurally or chemically similar residues should ideally have high diagonal or off-diagonal numbers • Structurally or chemically dissimilar residues should ideally have low diagonal or off-diagonal numbers

  16. A Better Matrix - PAM250

  17. Prokaryotic Gene Prediction Promoter Region -35 (TTGAC) Terminator (stem loop structure) -10 (TATAAT) Initiation codon (ATG) Stop codon (TAG,TAA, TGA) Shine Delgarno sequence RBS (G-rich)

  18. Prokaryotic Gene Prediction • ORF finder • http://www.ncbi.nlm.nih.gov/gorf/gorf.html • GLIMMER • http://www.tigr.org/softlab/glimmer/glimmer.html • GeneMark • exon.biology.gatech.edu/GeneMark/ • www.ebi.ac.uk/genemark

  19. Hidden Markov Model

  20. Eukaryotic Gene Prediction branchpoint site 5’site 3’site exon 1 intron 1 exon 2 intron 2 CAG/NT AG/GT

  21. Gene Predictors • GRAIL2 (http://compbio.ornl.gov/Grail-1.3/) • Neural Network Model CC=0.47 • HMMgene (http://www.cbs.dtu.dk/services/HMMgene/) • Hidden Markov Model CC=0.91 • GENSCAN (http://genes.mit.edu/GENSCAN.html) • Probabilistic Model CC=0.91 • GRPL (GeneTool) • Reference Point Logistics CC=0.94

  22. Evaluation Statistics TP FP TN FN TP FN TN Actual Predicted Sensitivity Fraction of actual coding regions that are correctly predicted as coding Sn=TP/(TP + FN) Specificity Fraction of the prediction that is actually correct Sp=TP/(TP + FP) Correlation Combined measure of sensitivity and specificity CC=(TP*TN-FP*FN)/[(TP+FP)(TN+FN)(TP+FN)(TN+FP)]0.5

  23. Gene Prediction Accuracy (%) Method

  24. What Works Best? • Expect only a single exon… • BLASTN vs. dbEST • BLASTX vs. nr(protein) • Fully sequenced data • Run GENSCAN + HMMgene + GRPL • Combine predictions (CC > 0.95) • BLAST vs. nr(protein) • Combine BLAST result with prediction

  25. The Genetic Code

  26. Translation Frame3 A Y S D A H Frame2 C V * R C A Frame1 M R I A M R I ATGCGTATAGCGATGCGCATT TACGCATATCGCTACGCGTAA Frame-1 H T Y R H A N Frame-2 R I A I R M Frame-3 A Y L S A C

  27. From Sequence to Function (and Structure) ACEDFHIKNMF SDQWWIPANMC ASDFDPQWERE LIQNMDKQERT QATRPQDS...

  28. PROSITE Pattern Expressions C - [ACG] - T - Matches CAT, CCT and CGT only C - X -T - Matches CAT, CCT, CDT, CET, etc. C - {A} -T - Matches every CXT except CAT C - (1,3) - T - Matches CT, CCT, CCCT C - A(2) - [TP]- Matches CAAT, CAAP [LIV] - [VIC] - X(2) - G - [DENQ] - X - [LIVFM] (2) -G

  29. PepTool Pattern Expressions C[ACG]T - Matches CAT, CCT and CGT only C*T - Matches CAT, CCT, CDT, CET, etc. C!AT - Matches every C * T except CAT C{1,3}T - Matches C*T, C * * T, C * * * T $CAA(TP]- Matches CAAT, CAAP at N terminus [LIV][VIC] * * G[DENQ] *[LIVFM][LIVFM]* G

  30. Protein Sequence Motifs • Pattern-Based (PQL) Sequence Motifs • >*TCP&NLGT* • DOOLITTLE, R.F., OF URFS AND ORFS (1986) • GUANIDINE KINASE ACTIVE SITE • Profiles or Position Scoring Matrix (PSSM) • A C D E F G H I K L M N P Q R • 1 W G V L V 3 -2 3 4 0 4 -1 3 -1 4 4 1 1 1 -2 • 2 L L S P L 2 -2 -2 -1 3 0 -1 3 -1 6 5 -1 3 0 -1 • 3 V V V V V 2 2 -2 -2 2 2 -3 11 -2 8 6 -2 1 -2 -2 • 4 K E A T A 6 -2 5 6 -5 4 1 0 5 -2 0 3 3 3 1

  31. C C C H2N H2N H2N COOH COOH COOH H H H Phosphorylation Sites pY pT pS PO4 CH3 PO4 PO4

  32. Phosphorylation Sites

  33. Glycosylation

  34. Glycosylation Sites

  35. Signaling

  36. Signaling Sites

  37. Protease Cut Sites

  38. Protease Cut Sites

  39. Binding Sites

  40. Family Signature Sequences

  41. Enzyme Active Sites

  42. Sequence Pattern Databases • PROSITE - http://www.expasy.ch/ • BLOCKS - http://www.blocks.fhcrc.org/ • DOMO - http://www.infobiogen.fr/~gracy/domo • PFAM - http://pfam.wustl.edu • PRINTS - http://www.biochem.ucl.ac.uk/bsm/dbrowser/PRINTS • SEQSITE - PepTool

  43. R V Q N C A A P L I A A Y A T A G G A A F A K H A Sequence Profiles

More Related