1 / 30

Impact of BVDV2 on U.S. Control Programs

Impact of BVDV2 on U.S. Control Programs. Julia Ridpath National Animal Disease Center Ames, IA. BVDV Variations. Biotype Cytopathic Noncytopathic Genotype BVDV1 BVDV2 Virulence type Continuum. Pestivirus Genotypes. BVDV1 vs. BVDV2. Similarities

floria
Télécharger la présentation

Impact of BVDV2 on U.S. Control Programs

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Impact of BVDV2 on U.S. Control Programs Julia Ridpath National Animal Disease Center Ames, IA

  2. BVDV Variations • Biotype • Cytopathic • Noncytopathic • Genotype • BVDV1 • BVDV2 • Virulence type • Continuum

  3. Pestivirus Genotypes

  4. BVDV1 vs. BVDV2 • Similarities • Most acute infections of adults subclinical • Exist as two biotypes • Noncytopathic can establish persistent infections • Differences • Antigenically distinct • Severe acute disease only observed with BVDV2 • Tend to undergo recombination in different positions • Recombinations in noncytopathic BVDV2

  5. Cross neutralization with polyclonal antisera

  6. Study Animals – Herd 1 • ~1,500 red Angus cows/heifers (cow-calf operation) • Spring (branding) – 4-way viral vaccine, MLV BVDV type 1 • Fall (weaning, early pregnancy) – 4-way viral vaccine, killed BVDV type 1 • >50 abortions/stillbirths, ~8% open cows/heifers in 2001 (typical for past several years) • >50 calves lost from birth  branding in 2001(typical for past several years) • Initiated calf ear notch BVDV testing in 2002: 26 known PI calves born in 2002, probably 20-30 more suspects that died before they could be tested • BVDV2 isolated from PI’s Courtesy of T. Cornish, Wyoming State

  7. Study Animals – Herd 2 • 170 red Angus heifers on bull production ranch • Spring – 4-way viral vaccine, MLV BVDV type 1 • Fall (preg check) – 4-way viral vaccine, killed BVDV type 1 • Fall – 163 tested pregnant • 11 abortions, 6 stillbirths (normal ~3) • 12 calves died birth  branding (normal ~2) • 134 calves branded, ear notch tested for BVDV: • 43 PI CALVES • Estimated losses - $41,500 • BVDV2 isolates from PI’s Courtesy of T. Cornish, Wyoming State

  8. Defining protection • Prevention (reduction) of clinical disease in acute infections • Prevention (reduction) of fetal infections • B or T cell mediated • B cell • >1/16 for reduction of clinical disease • >1/256 for prevention of viremia • T cell • Protection from homologous challenge in absence of serum antibodies

  9. Chart of MLV BVDV Vaccines

  10. Chart of Killed BVDV Vaccines

  11. What about fetal protection?

  12. Fetal Protection Against BVDV * Protected/Challenged Courtesy Dan Grooms, Mich. State

  13. BVD Decision / Management Guidelines for Beef Cattle Veterinarians Academy of Veterinary Consultants Adopted July 31, 2003

  14. Dan Grooms DVM Michigan State University College of Veterinary Medicine 517-432-1494 groomsd@cvm.msu.edu

  15. Dr. Grooms Starting Place For A BVDV Vaccination Program Cow-Calf • Replacement heifers • Two doses of type 1 and 2 BVDV completed 30 days prior to breeding. At least one dose should be MLV. • Cows • Type 1 and 2 MLV BVDV 30 days prior to breeding.

  16. Dr. Grooms Starting Place For A BVDV Vaccination Program Fed Cattle • Prefer preconditioning… 2 doses of type 1 and 2 BVDV, at least one being MLV • On arrival, type 1 and 2 MLV BVDV

  17. Vaccination is not a silver bullet • Vaccination alone is not sufficient for a control program • Surveillance alone is not practical for the industry • Can not guarantee 100% participation • Requires two pronged attack • Vaccination and Surveillance

  18. Appropriate diagnostic testing to determine • if Persistently Infected (PI) with BVDV • Testing Must Occur Before Start of Breeding Season • All calves (IHC test is appropriate for calves of all ages) • All cows without calves (open or calf died) (IHC, Ag-capture ELISA, VI, PCR) • All replacement bulls and heifers (purchased or raised) (IHC, Ag-Capture ELISA, VI, PCR) Test Positive Test Negative Retain in herd • Calves • Remove calf and dam from breeding herd • Confirm persistence of virus by retesting in 3 weeks • Euthanize calf • Test dam • Heifers, Bulls & Cows • Sell PI animals to slaughter • Safe for human consumption Test Dams • Test Negative • Return dam to breeding herd • Test Positive • Sell to slaughter • Safe for human consumption

  19. How safe are the new vaccines?

  20. Safety questions • Use in pregnant animals • Recombination is multivalent BVDV vaccines

  21. Cellular insert Type 2 BVDV CTTTGAGGAGAAACATTACAAAAAAATATTTATAAGAGAAGGATGC ||||| || | |||||||||| || |||||||| ||||| | TTTTGAAGAAAGGCATTACAAAAGGATTTTTATAAGGGAAGGTAAC • CACGACGGACCTTTCAGAGAAGAGTATAAGGGTTATATCCAATACGCAGCC • ||| || ||||||||| |||| ||||| |||| ||| ||||| | || TTCGATGGTCCTTTCAGACAAGAATATAATGGTTTTATACAATATACCGCT Type 1 BVDV 74.5% identity 73.9% identity Claim for dangers of recombination • The BVDV type 2 contains a dnaJ1 cellular insert • The BVDV type 1 has no cellular insert in this region. • The BVDV type 1 NS2-3 sequence can be used to “repair” the BVDV type 2 NS2-3, generating a noncytopathic recombinant, a potential risk for this vaccine.

  22. Opportunity, selection, immune response and field data • Recombinant between BVDV1 and BVDV2 takes month(s) to reach detectable levels • Result is always a cytopathic virus • Recombinant virus not recognized by PI immune system, which allowed it to replicate • In the non PI animal, virus would have been eliminated in 10 to 14 days • The mechanism behind MD acted as a strong selector for the recombined virus • No reports of post vaccinal PI reported to date for divalent vaccines

  23. Impact of subgenotype • BVDV1a and BVDV1b • BVDV1b prevalent genotype • Reports of BVDV1b breaking through BVDV1a vaccines • BVDV1b PI’s mount immune response to BVDV1a strains • BVDV2a and BVDV2b

  24. Antigenic Variation in BVDV1 Subgenotype Neutralizing titers 21 days post vaccination BVDV1a MLV 120 100 80 BVDV1a titer 60 titer BVDV1b titer 40 20 0 1 2 3 4 5 6 animal number

  25. 1997 1998 1999 2000 40 additional pregnant heifers added 48 animals abort or reabsorb fetus 100 pregnant heifers purchased Animal #875 born BVDV recovered from fetus Vaccination program changed Milking herds combined Vaccination protocol 2 doses killed vaccine (type 1 and 2) at dry off and 2 to 3 weeks postpartum Vaccination protocol 1 dose killed at dry off and 1 dose MLV (type BVDV1a) at 3 to 4 weeks postpartum Persistent virus was a BVDV1b

  26. Your invitation to the next U.S. BVDV meeting • February 2006 • Denver, Colorado • Held in conjunction with the National Cattleman’s Beef Association meeting

More Related