1 / 13

Novel splice-site mutations as the cause of FAP-related cancer in two families

Novel splice-site mutations as the cause of FAP-related cancer in two families. K Sweet , B McIlhatton, V McConnell, W Logan and C Graham Regional Molecular Genetics Laboratory, Belfast. APC-Associated polyposis conditions. Familial adenomatous polyposis (FAP) >100 adenomatous colonic polyps

gali
Télécharger la présentation

Novel splice-site mutations as the cause of FAP-related cancer in two families

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Novel splice-site mutations as the cause of FAP-related cancer in two families K Sweet, B McIlhatton, V McConnell, W Logan and C Graham Regional Molecular Genetics Laboratory, Belfast

  2. APC-Associated polyposis conditions • Familial adenomatous polyposis (FAP) • >100 adenomatous colonic polyps • Often thousandsof colonic polyps • Polyps present throughout the colon • Early age of onset • Germline mutations in APC gene • Autosomal dominant • Attenuated FAP (AFAP) • Fewer colonic polyps (<100) • Later age of onset

  3. AFAP Classic FAP AFAP 436 1596 MUTATION CLUSTER REGION 1061 1309 5bp mutation Hot Spots ARMADILLO REPEATS B-CATENIN BINDING DOMAIN FUNCTONAL DOMAINS MICROTUBULE BINDING DOMAIN B-CATENIN DEGRADATION DOMAIN EB1 BINDING DOMAIN Grady and Markowitz APC Gene 2843 (aa) 500 1000 1500 2000 Ex 1 3 5 9/9a 10 11 12 13 14 15

  4. APC Mutations Molecular genetic testing using range of techniques including MLPA, PTT and DNA sequencing Mutation detection rate – up to 90%

  5. Case 1 ? II:1 II:2 II:3 II:4 II:5 II:6 II:7 9 sibs III:1 • Age 47- Adenocarcinoma • APC Ex 15 PTT - Negative • Colonoscopy - > 100 + polyps located proximal and distal to tumour • APC Ex 1-14 screen c.1409-5A>G in intron 10 • Suspected family history of colon cancer on maternal side

  6. 2843 (aa) 500 1000 1500 2000 Ex 1 1 3 5 9/9a 10 11 12 13 14 15 ARMADILLO REPEATS c.1409-5 A>G APC Gene AFAP FAP with CHRPE AFAP 436 1596 Exon 11 G CCCTTTTTAA TTAG GGGGACTAC A • Splice acceptor site • Fruitfly and SpliceSiteFinder prediction programmes predicted use of alternative splice site. Score – 80.6 • Previously reported in large European study – Pathogenicity undetermined Friedl & Aretz, 2005

  7. c.1409-5A>G DNA cDNA Splice acceptor site G CCCTTTTTAA A TTAG GGGGACTAC Ex 11 Intron 10 Alternative splice site 4bp insertion – (p.G470Vfsx15) RNA CCCTTTTTAAGTTAG GGGGACTAC N N M AATGAACTAGTTAGGGGGACTACAGGC,,,,TGA 254bp Ex11 Ex10 250bp Term Molecular analysis

  8. Case 2 Breast Ca II:1 II:2 II:3 II:4 II:5 II:6 ? Colon Ca Melanoma Jejunal Ca ? Colon Ca • MYH gene - Negative III.2 • APC Ex 15 PTT - Negative • Age 55 - Carcinoma of sigmoid colon • APC Ex 1-14 Screen • Age 62 - Multiple polyps throughout colon c.423 G>T (p.R141S) Exon 4 APC gene

  9. Case 2 Breast Ca II:1 II:2 II:3 II:4 II:5 II:6 AFAP AFAP III:2 III:3 III:4 III:5 AFAP AFAP c.423 G>T Splicing mutation PRESENT

  10. 1 3 5 9/9a 10 11 12 13 14 15 c.423G>T p.R141S APC Gene AFAP AFAP (aa) 500 1000 1500 2000 4 • Conserved amino acid sequence • Predicted to disrupt splice-site – (Fruitfly and SpliceSiteFinder and prediction programmes) • Reported by Aretz et al., 2004. Human Mutation 24(5): 370-80

  11. Ex4 Ex3 RNA II.2 II.2 II.4 III.3 III.3 N Ex3 Ex5 Ex3 Ex4 301 Ex5 192 Molecular analysis Intron 3 Exon 4 c.423G>T DNA AAGAGAG GTCAATTGCTTCTTGCT T Ex5 109bp Exon skipping confirmed by sequence analysis of the cDNA product across junction.

  12. Summary • Case 1 – Atypical FAP • c.1409-5 A>G mutation – • Splice-site prediction programmes • RNA studies • Selection of an alternative splice site. • Case 2 – AFAP • c.423 G>T (p.R141S) missense mutation – • Amino acid conservation • Segregation with disease • Splice site prediction programmes • RNA studies • Exon skipping possibly due to possible effect on exonic splicing enhancer motifs (ESEs). (Aretz et al., 2004).

  13. To conclude… • Splicing mutations can cause FAP and warrant further investigation • CMGS Best Practice Guidelines on the interpretation and reporting of unclassified variants

More Related