Gene expression…
E N D
Presentation Transcript
Gene expression… - Pooja Gupta
Gene is expressed by transcribing DNA into single-stranded mRNA • mRNA is later translated into a protein • Cells are different because of differential gene expression • About 40% of human genes are expressed at one time • mRNA expression represents dynamic aspects of cell
DNA transcription mRNA translation Protein Gene expression CCTGAGCCAACTATTGATGAA CCUGAGCCAACUAUUGAUGAA PEPTIDE
mRNA Stability The amount of translatable mRNA is a product of both synthesis and decay: SynthesisDecay DNA → mRNA→ Nucleotides
Synthesis Decay →[mRNA] → When d(mRNA)/dt = 0; Rate of synthesis = Rate of decay ∴mRNA at “Steady State”
Regulation of [mRNA] Any change from one steady-state to another may be due to a change in the rate of synthesis or the rate of decay, or both. Therefore, when mRNA levels increase, we are unable to conclude that the increase was due to increased transcription. However, this change in [mRNA] usually leads to a change in translation (change in functional capability of cell).
Detection and quantification of RNA transcripts • Various methods for detection and quantification of mRNA are available, however they are differ by: • Accuracy • Sensitivity • Throughput
Overview Gene expression • mRNA • protein Northern Blots RPA RT-PCR SAGE MicroArray
Ultimate goal is to develop the ability to scan the mRNA expression state of all the genes for a particular genome simultaneously
Northern Blot Slot Blot Northern Blots Cellular RNA separated by gel electrophoresis Separated mRNA pattern transferred to nylon membrane Hybridized with radioactive probe (made from cDNA clone)
RNase Protection Assay • More sensitive, more precise than Northern • Synthetic, radioactive RNA transcribed • from cDNA clone • Probe hybridized with mRNA in solution • RNase destroys unpaired probe • “Protected” probe separated by hi-res gel electrophoresis
RPA (continue) • Presence of protected band indicates • presence of mRNA • Intensity indicates steady-state [mRNA] • Combine several probes to several mRNAs • Identify by characteristic size • Very sensitive, very specific!
RT-PCR Measures relative expression of mRNA 1. Isolate and purify mRNA 2. reverse transcription 3. PCR amplification 4. run on gel and probe/hybridize
RT-PCR Why use RT? Can observe very low levels of expression Requires very small amounts of mRNA The bad… Potential expression-level skew due to non-linearity of PCR Have to design multiple custom primers for each gene.
SAGE Tags are isolated and concatermized. Relative expression levels can be compared between cells in different states.
SAGE --gene to tag mapping http://www.ncbi.nlm.nih.gov/SAGE/SAGEcid.cgi?cid=28726
Microarray - A Glass slide or silicon chip onto which spots of many different DNA probes have been deposited. Used for simultaneous measurement of gene expression levels of many genes in the same tissue sample.
What we hope to learnMicroarrays • Understand the principles of the microarray technique. • Appreciate the limitations of microarrays and problems associated with the technique. • Know what types of output are generated from different microarray analysis packages and what they mean. • Understand and be able to evaluate research papers about microarrays.
Why Learn about Microarrays ? • Extremely useful and powerful technology – given a sample of human tissue, allows you to determine the expression level of all human genes within that tissue. • Now extremely widely used, not only in research laboratories but also within commercial companies and diagnostically in hospitals. • Many research articles written involving microarray data – bioinformatics is vital for understanding these data and results.
Microarrays are Popular • The NYU Med Center collects about 3 GB of microarray data per week • NCBI GEO 80K curate sample sets • PubMed search "microarray"= 13,948 papers • 2005 = 4406 • 2004 = 3509 • 2003 = 2421 • 2002 = 1557 • 2001 = 834 • 2000 = 294
3. Scan 2. Wash Over Array What is a Microarray ? • Mark Schena, one of the founders of the technology in early 1990s at Stanford, says microarrays need to be: • Microscopicordered arrays of specific probes on a planar surface. Sample 1. Label sample
3. Scan 2. Wash Over Array For Example - Protein Microarrays Different Proteins Different Antibodies Sample 1. Label sample
3. Scan 2. Wash Over Array Our Focus – Gene Expression Microarrays Complementary DNA sequences Different mRNAs Sample 1. Label sample
3. Sequence specific nucleic acid hybridization A A T A U U A A A T T T T A T A C C G C C G G C A U U A A A A U T T A A 2. Reverse transcription to cDNA and labelling G G T T Gene Expression Microarrays –Key Concepts Tissue biopsyor cell culture 1. mRNA extraction
Goals of a Microarray Experiment • Find the genes that change expression between experimental and control samples • Classify samples based on a gene expression profile • Find patterns: Groups of biologically related genes that change expression together across samples/treatments
Two Major Gene Expression Microarray Technologies Spotted Arrays AffymetrixGeneChips We will examine their manufacture and their use.
Spotted Microarrays – Manufacture Pat Brown has plans $30K • DNA probes spotted onto the microarray can either be cDNA created by PCR or synthetic oligonucleotides. • The probes are physically spotted onto particular positions on a glass slide using a robot and immobilized using specific surface chemistry.
Spotted Microarrays – Manufacture Spotted microarrays can also be manufactured ‘by hand’.
Spotted Microarrays – Example Use • As an example, we will look at detecting differences between acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML) . This was one of the first successful uses of microarrays in cancer classification. • Total mRNA was extracted from bone marrow taken from patients with ALL and AML. • Converted to cDNA by reverse transcription (since mRNA is sensitive to degradation). T.R. Golub et. al (1999) Molecular Classification of Cancer: Class Discovery and Class Prediction by Gene Expression Monitoring. Science, vol. 286, 531-537.
Spotted Microarrays – Two Channels ALL cDNAs AML cDNAs Spot Interpretation Green Spot – higher expression in ALL. Red Spot – higher expression in AML. Yellow Spot – equal expression in both. Black Spot – not expressed in either. Cy3 DyeLabel Cy5 DyeLabel Mix and hybridize onto slide
Affymetrix GeneChip –Manufacture Oligonucleotides are synthesized one nucleotide at a time on the surface of a quartz wafer using photolithographic chemistry in clean room conditions.
Affymetrix “Gene chip” system • Uses 25 base oligos synthesized in place on a chip (20 pairs of oligos for each gene) 20,000 genes/chip • RNA labeled and scanned in a single “color • Arrays get smaller every year (more genes) • Chips are expensive • Proprietary system: “black box” software, can only use their chips
Affymetrix GeneChip – Single Channel Hybridize Scan ALL cDNAs Biotin Label AML cDNAs