ghurd
Uploaded by
25 SLIDES
275 VUES
250LIKES

DNA makes ____ makes ________ .

DESCRIPTION

Explore the intricate process of gene expression, from DNA transcription to protein synthesis, through RNA intermediaries like mRNA and tRNA. Unravel the genetic language and mechanisms governing the fundamental biological process of translating genetic information into functional proteins.

1 / 25

Télécharger la présentation

DNA makes ____ makes ________ .

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From DNA to Proteins Chapter 13 • DNA makes ____ makes ________. • Proteins are the links between ___________ and ________________.

  2. The bridge between DNA and ________synthesis is RNA. RNA differs from DNA 1. RNA contains _____as its sugar (not deoxyribose) 2. _______ replaces thymine. AGTCAT becomes AGUCAU 3. An RNA molecule almost always consists of a _______strand. This is an H in DNA Fig. 6.8a ___________ and ___________ are the two main processes linking gene to protein

  3. 4 types of RNA ________ - carries info for protein production _______-transport amino acids in translation _______- part of ribosome, has role in translation ________ - splicing mRNA

  4. Chromosome- 1.5 x 108 base pairs containing about 3000 genes UAA UAA 0.4% of a chromosome, containing 10 genes = 1. ________________ = 2. ________________ F B C D E TAA ATG DNA 5’ 3’ 3’ 5’ +1 AATAAA 3. _____________ AUG Pre-mRNA 4._________ 5. ______ 6. ____________ E A B C D F 7mG AAAAAA….. AUG 7. ________________ Protein COO- NH2

  5. ____________ - DNA is the template for RNA, usually __________ RNA (mRNA). • ____________________ - the information contained in the order of nucleotides in mRNA is used to determine the __________ sequence of a polypeptide. • -Translation occurs at ____________. Fig. 17.2a • The basic mechanics of transcription and translation are ________ in eukaryotes and prokaryotes.

  6. In the __________, three consecutive bases specify an amino acid, creating 43 (64) possible ________. The genetic instructions for a polypeptide chain are written in DNA as a series of three- __________words. In the genetic code, nucleotide triplets specify amino acids

  7. 1. ___ of 64 triplets code for amino acids. AUG codes for the methionine and____of translation. The genetic code Know how to read this chart!! • Three codons –___, ___ and ____do not code amino acids but signal the termination of translation. 2. The genetic code is __________but not_ _________ . • Typically several different codons specify a given amino acid • Any one codon indicates _ __________ amino acid. Fig. 17.4

  8. The genetic code (cont.) Know how to read this chart!! A ______________ is established at the translation start 3’ RNA 5’ UUACGAUGGAUUCAAACGUCAGGGCCUAAGGCUAG Met Asp Ser Asn Val Arg Ala Stop codon Start codon Summary- The genetic code uses_ ____________________, or codons, each of which is translated into a specific amino acid.

  9. The genetic code is nearly ______________ , from bacteria to mammals Thus, we can synthesize bacterial proteins in ______________ • Exceptions do exist- they use slightly altered genetic codes: • 1.single-celled eukaryotes like • Paramecium. 2. certain mitochondria and chloroplast ____________

  10. Messenger RNA is transcribed from the template strand of a gene by ________________. __________________________: separates the DNA strands bonds the RNA nucleotides as they base-pair along the DNA template. What actually makes the RNA? RNA 5’ 3’ DNA 3’ 5’

  11. What marks the start of transcription?? • Answer- Specific sequences of nucleotides called the _________ mark where gene transcription begins • In prokaryotes, RNA polymerase can recognize and bind ______________ to the promotor region. • In eukaryotes, proteins called ___________ first bind the promotor region, especially a __________, then RNA polymerase II binds

  12. snipped out snipped out Transcript Modification unit of transcription in a DNA strand 3’ 5’ exon intron exon intron exon transcription into pre-mRNA poly-A tail cap 5’ 3’ 5’ 3’ mature mRNA transcript

  13. Overview of eukaryotic transcription/translation Chromosome- 1.5 x 108 base pairs containing about 3000 genes 3’ 5’ 3’ 5’ 0.4% of a chromosome, containing 10 genes UAA UAA = exon = intron F B C D E TAA ATG DNA +1 Template strand Transcription AAUAAA AUG hnRNA Regulatory DNA sequences RNA Splicing polyA tail,cap Transport to cytoplasm E A B C D F 7mG mRNA AAAAAA….. AUG Translation Protein COO- NH2

  14. How do proteins read the RNA molecule?? Answer-the ___________________ tRNA • _____________ (tRNA) - transfers amino acids from the cytoplasm’s pool to a ________________. • The ribosome adds each amino acid carried by tRNA to the growing end of the _________________ chain. ribosome

  15. A tRNA molecule Is about ___nucleotideslong Contains attachment site for an amino acid. Contains a loop with the ___________ Fig. 17.13 3’ 5’ The anticodon base-pairs with a complementary codon on mRNA. • If the codon on mRNA is UUU, a tRNA with a • ______ anticodon and a tRNA carrying phenylalanine will bind to it.

  16. Translation Translation can be divided into three ______ 1. initiation2. _________ 3. termination 1. Initiation • Small ribosomal subunit binds mRNA • Initiator tRNA (with methionine) is attached to start codon Fig. 17.17

  17. Translation 2. Elongation - Amino acid sequentially added c. Translocation - the ribosome moves the tRNA with the attached polypeptide from the A site to the P site.

  18. 3. Termination occurs when ribosome reaches a _____codon. A ____________binds to the stop codon and hydrolyzes the bond between the polypeptide and its tRNA in the P site. Translation Fig. 17.19 Other translation facts • Multiple ribosomes, polyribosomes, may trail along the same _______. • A ribosome requires less than a ________ to translate an average-sized mRNA into a polypeptide. Fig. 17.20

  19. Transcription Overview rRNA tRNA mRNA Mature mRNA transcripts ribosomal subunits mature tRNA Translation

  20. Point mutations can affect protein structure and function • __________are changes in the genetic material of a cell (or virus). • include large-scale mutations in which _____segments of DNA are affected (translocations, duplications, and inversions). • A chemical change in just one base pair of a gene causes a _______________ In sickle cell, a single T to A mutation changes amino acid from glu to val • _________ - alterations of nucleotides still indicate the same amino acids because of redundancy in the genetic code. • Many other mutations cause no effect in function

  21. Other base-pair substitutions cause a readily detectable change in a protein. _______mutations are those that still code for an amino acid but change the indicated amino acid. _______mutations change an amino acid codon into a _____ codon, nearly always leading to a nonfunctional protein. Fig. 17.24

  22. Insertions and ______are additions or losses of nucleotide pairs in a gene. These have a _________ effect on the resulting protein more often than substitutions do. Unless these mutations occur in multiples of ____, they cause a________mutation. All the nucleotides downstream of the deletion or insertion will be improperly grouped into codons. The result will be extensive missense, ending sooner or later in nonsense - premature termination. Fig. 17.24

  23. ______________Mutation Really bad!! mRNA PARENTAL DNA amino acid sequence ARGININE GLYCINE TYROSINE TRYPTOPHAN ASPARAGINE altered mRNA BASE INSERTION altered amino acid sequence ARGININE GLYCINE LEUCINE LEUCINE GLUTAMATE

  24. __________are chemical or physical agents that interact with DNA to cause mutations. ________agents include high-energy radiation like X-rays and ultraviolet light. __________ mutagens may operate in several ways. As base ____________that may be substituted into DNA, but that pair incorrectly during DNA replication. Interfere with DNA replication by inserting into DNA and distorting the ______________. Cause chemical changes in bases that change their pairing properties.

  25. Unwinding of gene regions of a DNA molecule TRANSCRIPTION Pre mRNA Transcript Processing mRNA rRNA tRNA protein subunits Mature mRNA transcripts ribosomal subunits mature tRNA Convergence of RNAs TRANSLATION Cytoplasmic pools of amino acids, tRNAs, and ribosomal subunits Synthesis of a polypetide chain at binding sites for mRNA and tRNA on the surface of an intact ribosome FINAL PROTEIN Fig. 13.14, p. 210 Destined for use in cell or for trasport

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer