Exploring Promiscuous Protein Domains and DNA/Protein Motifs through Pedagogy and Practice Part 2

1. Exploring Promiscuous Protein Domains and DNA/Protein Motifs through Pedagogy and PracticePart 2 Salvador Cordova

4. Evolutionary Genomics Group at NIH, NCBI Same Institution which fired Evolutionary Biologist Richard Sternberg Resulting in Congressional Investigation

5. Some Promiscuous Domains and Motifs are also Overlapping Codes Example of Overlapping Code: Enhancers on Exons Potential Example Overlapping Code and Promiscuous Motif: PTM Kinase Targets Genetic Entropy: First encounter with Overlapping Codes Hypothesis

7. BIOTIC MESSAGE "Life is the product of a single designer - life was intentionally designed to resist all other interpretations of origin." -- Walter ReMine "Did he create to mimic evolution and test our faith thereby?" Stephen Gould

8. For many people, there is irresolution -- life looks created, but life also looks evolved! ReMine vs. Gould

9. Life looks created, but life also looks evolved • Paradox of the Straight Pencil Looking Bent • Prior to Snell, people might have concluded that the weight of evidence indicated that when a stick/oar was in the water it was straight even though it looked bent. • However, it’s reasonable to suppose some people would have been curious to explain the reason for the illusion of a bent stick in water. And until Snell, there wasn’t a rigorous and codified explanation. • Snell’s Law gave a coherent explanation for the illusion. • In contrast, no such “Snell’s Law” exists yet to explain appearance of universal common descent even if one already accepts special creation • “Does anyone suppose that if something is straight, then it jolly well has to look straight at all times and in all circumstances?” J. L. Austin Willebrord Snell 1580-1626

10. Geocentrism vs. Heleocentrism Which echoes the debate over whether to view biology through perspective of Common Descent vs. Common Design (to be fair, some ID proponents do not view the two perspectives as mutually exclusive)

11. Geocentrismvs.Heleocentrism • The appearance of the sun rising and setting every day gives the illusion of geocentrism • The anomaly of retrograde motion signaled the end of geocentrism (subtle argument) – epicylces were concocted to resolve anomaly from geocentric viewpoint (epicycles made some testable predictions that agreed with observations!) • One could commit to the wrong idea if they insisted on doing so: “We will see some who are so deranged, not only in religion but who in all things reveal their monstrous nature, that they will say that the sun does not move, and that it is the earth which shifts and turns. When we see such minds we must indeed confess that the devil posses them” John Calvin (1509-1564) • Heliocentrism solves motions in agreement with presence of centrifugal, Coriolliss and gravitational forces measured on Earth and in the Solar System – i.e. you can sense when you’re spinning, we can also sense the Earth is spinning with sensitive instruments • Subtle arguments -- so too with Common Descent vs. Common Design

12. “God wouldn’t do it that way” “The pencil bends when dipped in water, because God would not deceive us with something that appears to be bent when it isn’t. So the pencil must be bent because it looks bent!” “The sun rises and the Earth is stationary, because God would not deceive us with a sun that appears to rise. So the Earth must be stationary, because the sun rises.” NOTE: Geocentrism is a POWERFUL illusion! “Life is evolved by universal common descent, because God would not deceive us with life that looks evolved. So life evolved because it looks evolved, because otherwise evolution is a great deception by God!” NOTE: Universal Common Descent is also a POWERFUL illusion, but has metaphysical implications.

13. Challenges for the special creation viewpoint • Designer not directly seen • Miracles are not repeatable, we would like to repeat on demand in order to believe (but if we could repeat miracles on demand, we would be God!) • Patterns of Similarity and Diversity • Problem of Evil, Bad Design (not really a scientific argument, but deal breaker for many)

14. Recap Part 1

15. ZNF136 Sequence 1 KRAB-A domain, 13 C2H2 Classical Zinc Finger Domains

16. ZNF136 Sequence 1 KRAB-A domain, 13 C2H2 Classical Zinc Finger Domains KRAB-A domain Each line is a valid C2H2 zinc finger domain

22. Random cut/copy and paste of protein domains? Not quite as bad as Ohno’sframeshift hypothesis, but still bad.

23. Keys may obey the same general shape but have slight differences in notches and slots Likewise zinc fingers conform to same architectural principles with slight variation in amino acids in regions that allow for variability while maintaining same basic architecture Non conserved regions are functionally critical, not free to change randomly! Conservation can be a dubious metric for functionality!

24. Array of multiple side-by-side zinc fingers targets and connects to specific DNA addresses AACGCGCCCGATCTCGTCTGATCTCGGAAGCTAAGCAGGGTC NOTE: segment of 5S DNA

26. Coding Part of Gene

27. Is this “phylogeny” a valid reconstruction of history? • Emphatic “NO” as a matter of principle -- my opinion

28. Classical C2H2 Zinc Finger Motif/Domain in ZNF136

29. about 50-60% sequence similarity depending on scoring technique

32. Collagens account for around 25% of the protein mass in our bodies!

33. FASTA sequence of Collagen Type 1, Alpha 1 paralog (1464 aa)

35. About 75% similarity depending on scoring technique

36. Hierarchy gives appearance of common descent but there are hints of designed evolution

37. Amino acid sequences and associated chemical properties in a functional context are too different for one functional architecture to evolve from another!

38. Machines With Similar Conceptual ArchitecturesDifferent Implementations, Some Shared Parts and/or MaterialsNo Plausible Transitionals between Architectures Pianos Blenders Cars

39. Proteins can be arranged into families if they conform to the same basic architecture. They naturally form “phylogenetic” trees. However, it’s a force-fit to say the architectures themselves have a common ancestor.

40. Problem extends all the way up to a hypothetical Protein Universal Common Ancestor (PUCA) PUCA doesn’t exist Foreshadows Orphan Gene and Taxonomically Restricted Gene Problem

41. All major protein families do NOT share a common ancestral protein

42. All major protein families do NOT share a common ancestor • Defensible for the simple reason evolutionary biologists (quietly) reject existence of a Protein Universal Common Ancestor( PUCA) • Evolutionary biologists accept LUCA (Last Universal Common Ancestor), even though they reject PUCA (quietly, not formal declarations to that effect)

43. Evolutionary Biologists (implicitly, reluctantly perhaps unwittingly) accept the orchard model for major protein families, but NOT for organisms Foreshadows the TRG (Taxonomically Restricted Gene) and orphan gene problem

44. Resolution to some paradoxes “We see trees, but they are in orchards” “Common descent is in the unenviable position of needing miracles of special creation to make common descent viable!” -- Me

45. Why did God make other creatures? • Creation would be obvious if there weren’t other creatures on the planet, but just made humans, right? (maybe, maybe not) • At least there would be no problem of the appearance of evolutionary phylogenetic trees if no other creatures • ID Proponent Mike Gene: “If God wanted to persuade us of special creation, then why would he make chimps that look so similar to man?”

46. What if God only made humans andno other creatures? • Biology research would require humans to sacrifice their body parts and themselves to learn about biology!!!! “Anyone want to volunteer themselves for a dissection?” • God could speak from the skies as He did to the Prophets and Apostles, but apparently he chose to be SUBTLE and allow us to discover truth through science!

47. The Lord God is subtle, but malicious He is not. -- Einstein Nature hides her secret because of her essential loftiness, but not by means of ruse -- Einstein It is the glory of God to conceal a matter, the glory of Kings is to search out a matter. -- Proverbs 25:2 God delights in concealing things; scientists delight in discovering things. ----(message “translation” Proverbs 25:2)

48. SPECULATIONPatterns of similarity can be interpreted philosophically as a gift from the Designer for scientific discoverability, like fine tuning of the universe (Earth designed for scientific discovery)Biotic Message (ReMine), Steganography(Dembski), Privileged Planet (Gonzalez, Richards)

49. Pan genome venn diagram of genes unique and shared We see orphan gene/taxnomically restricted gene problem in diagram http://www.sci-news.com/genetics/article01036.html

50. Pan genome venn diagram of genes unique and shared We see orphan gene/taxnomically restricted gene problem in diagram http://www.sci-news.com/genetics/article01036.html