gotzon
Uploaded by
25 SLIDES
449 VUES
250LIKES

From DNA to Protein

DESCRIPTION

From DNA to Protein. True Purpose of Genetic Material – Central Dogma. A. Overview. DNA, as genetic blueprint of life, dictates how to make every living thing Every cell’s job is to produce protein Why protein? Animals : enzymes, membranes, organelles, muscle, skin, hair = protein

1 / 25

Télécharger la présentation

From DNA to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From DNA to Protein True Purpose of Genetic Material – Central Dogma

  2. A. Overview • DNA, as genetic blueprint of life, dictates how to make every living thing • Every cell’s job is to produce protein • Why protein? • Animals: enzymes, membranes, organelles, muscle, skin, hair = protein • Plants: enzymes, membranes, organelles = protein • Life = protein!

  3. Making protein is cell’s doctrine or dogma • Central dogma: steps necessary to produce protein • Step 1: DNA transcribed to RNA • Step 2: RNA translated to protein

  4. B. Transcription (txn) • Double-stranded (ds) DNA found in nucleus of eukaryotes (cytoplasm of prokaryotes) • Code of bases (A-C-G-T) on DNA determines what type of protein synthesized in cytoplasm • Problem: DNA trapped in nucleus, can’t leave • Solution: use different nucleic acid that’s able to leave nucleus = single-stranded (ss) RNA (ribose nucleic acid or ribonucleic acid)!

  5. DNA vs. RNA

  6. Steps of Txn (nucleus) • Step 1: RNA polymerase binds to DNA • Step 2: RNA polymerase unwinds & unzips DNA • Step 3: RNA polymerase adds complementary RNA bases to DNA • All bases are same as DNA except RNA uses uracil instead of thymine DNA: A T C C A G G T C A T G C A A G C RNA: RNA: U A G G U C C A G U A C G U U C G

  7. Txn can occur at different DNA forks (just like replication) • Different segments of DNA called “genes” that code for different proteins/items T A C G A T T A C A G C A Gene 1

  8. C. RNA • Three types of RNA made depending on work needed • Messenger RNA (mRNA) • brings information from DNA in nucleus to outside cytoplasm • Ribosomal RNA (rRNA) • Contains ribosome that clamps onto mRNA to put amino acids in right order • Transfer RNA (tRNA) • carries amino acids to rRNA for assembly

  9. Nucleic acid double-strand Single-strand PO4 Deoxy-ribose adenine RNA DNA ribose cytosine thymine uracil guanine

  10. D. Translation (trl) • Act of making protein from mRNA • Recall: amino acids are building blocks of proteins • mRNA sequence is “read” • Nucleotide sequence codes for 20 different types of amino acids • Group of 3 nucleotides (triplet or codon) codes for 1 amino acid • Ex: UUU codes for phenylalanine UAC codes for tyrosine

  11. = asparagine Ex: AAC mRNA Codes

  12. Let’s practice: • Step 1: put blocks around every 3 bases (1 codon) • Step 2: look up letters in mRNA code • Step 3: write down amino acid sequence - leucine lysine - proline - lysine - alanine - asparagine AAACCUAAGGCCAACCUAAGGACC - arginine - threonine

  13. Trl has repetition to compensate for possible mistakes & codes to start & stop • Repetition: proline is coded for by CCU, CCC, and CCA • Start: codon AUG is where tln starts (methionine) • Stop: codons UGA, UAA, UAG where trl stops • Try it again! • Do NOT start boxing codons until see START codon “AUG” • Stop translating when see STOP codon (UGA, UAA, or UAG) AACCAUGAAGGCCAACCUAUAGGACCG Protein = methionine–lysine-alanine-asparagine-leucine

  14. Translation

  15. Steps of Translation • 1. DNA undergoes transcription in nucleus to make mRNA • 2. mRNA leaves nucleus, enters cytoplasm & travels to ribosome (solo or on roughER) • 3. free-floating tRNA binds to free-floating amino acids in cytoplasm based on anticodon & transports them to rRNA/ribosome complex • 4. ribosome bonds codon in mRNA to anticodons in tRNA, binding amino acids in right order until reaches STOP codon

  16. Step 1: Txn in Nucleus ribosome tRNA amino acid dsDNA mRNA

  17. Step 2: mRNA  ribsome mRNA dsDNA mRNA

  18. Step 3a: tRNAbinds aa mRNA dsDNA

  19. Step 3b: tRNA/aato ribosome try Amino acid tRNA mRNA dsDNA mRNA A C C anticodon

  20. his Step 4a: tRNA/aato mRNA try met tRNA tRNA tRNA Ribosome G U A A C C U A C C A U U G G U A A G A U G mRNA

  21. try met his Step 4b: aa join as protein tRNA tRNA tRNA Ribosome (rRNA) A C C U A C G U A C A U U G G U A A G A U G mRNA

  22. QUIZ – Thursday 12/6/12 • 20 multiple choice questions (20 points) • 2 short answer (10 points)

More Related