1 / 39

Today

Today. Start insertion amplicon into vector *.ppt Brief intro TA cloning USE ORIGINAL PROTOCOL for cloning (topo-isomerase, TA, plating) Cloning Sanger Sequencing Edit Sanger sequencing snail 16S/COI. Position Lovelace Respiratory Research Institute (LRRI).

guri
Télécharger la présentation

Today

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Today • Start insertion amplicon into vector • *.ppt • Brief intro TA cloning • USE ORIGINAL PROTOCOL for cloning (topo-isomerase, TA, plating) • Cloning • Sanger Sequencing • Edit Sanger sequencing snail 16S/COI

  2. Position Lovelace Respiratory Research Institute (LRRI) • LRRI looking to hire an undergraduate student as part time lab assistant • “doing dishes, checking eyewash stations, etc. It’s not very glamorous but the ones who have worked for us have been promoted to an actual full time position once they graduate”.  • The position is open and students can apply online at www.lrri.org/careers the job number is 2018.173.S and the job title is Laboratory Technician PRN. 

  3. SNAILAND PARASITES BIOLOGY DNA “identity, possibilities” phylogenetics CTAB/DNAzol CTAB/DNAzol Illumina (full) genome sequencing gel electrophoresis nanodrop spec PCRrDNA/mito Qubit Fluorometry Covaris fragmentation Ampure (fragment collection) Kapa DNA library preparation kit Pippin size selection QC Bioanalyzer, Qubit, qPCR Illumina run TA cloning, B/W screening electrophoresis Qiagen plasmid extraction Restriction digests direct sequencing M13 sequencing Sequence ID (BLAST) editing Galaxy QC Data file (MT) genome assembly Mitos, manual annotation Gene annotation Primer design, walking Phylogenetics GenBank submission

  4. Bring your LAPTOP Use W7 LAPTOP URL: http://emil.unm.edu/galaxy Login: UNM account id without @unm. pw:4546L2018 September 24th, Dr LiJing Bu

  5. FIRST STEP EXPERIMENTS TODAY Cloning insertion Group PCR reaction 1 1.3(EP1_18S) 2 9.3(EP3_18S) 3 10.3(EP1_18S) 4 10.4(EP1_28S) 5 10.3(EP1_18S) 6 10.3(EP1_18S) 7 9.3(EP3_18S) 8 10.4(EP1_28S) 9 9.3(EP3_18S) 10 10.4(EP1_18S) ADD 4 microliter to MASTERMIX (SPIN)LEAVE AT ROOM TEMP

  6. *.ppt

  7. Consider PCR results MW 18S and 28S PCR reactions yielded double or weak bands of “large size” (>800 bp) This will challenge analysis by direct sequencing (why?). Cloning to the rescue! MW

  8. Plasmid: Small circular DNAmolecule that replicates independently of the genome. Modified plasmids are used extensively as plasmid vectors for DNA cloning. Figure 8-30The insertion of a DNA fragment into a bacterial plasmid with the enzyme DNA ligase The plasmid is cut open with a restriction endonuclease (in this case one that produces cohesive ends) and is mixed with the DNA fragment to be cloned (which has been prepared with the same restriction nuclease), DNA ligase, and ATP. The cohesive ends base-pair, and DNA ligase seals the nicks in the DNA backbone, producing a complete recombinant DNAmolecule. (Micrographs courtesy of Huntington Potter and David Dressler.)

  9. WHY clone? • Produce reliable source (amount) of templatefor stepwise repeated sequencing reactions • Separate mixed amplicons (one insert/plasmid/bacteria) • Provide universal sequencing primers (Expression of proteins, etc..)

  10. BECAUSE OF TEMPLATE INDEPENDENT 3’ A-ADDITION TO AMPLICON MORE EFFICIENT THAN LIGASE

  11. Manual is online: http://biology.unm.edu/cmadema/4546_18/TOPOTA.pdf

  12. Combine in a snap cap NOTE vector and salt already mixed

  13. 1) Do 15+ minutes • Add 6 ml Use HALF vial of One Shots 2) Do 15 minutes ice MBF 7) Spread 10 on one plate and100 on another

  14. Sequencing PARAMETERS PRIMER SEQUENCES THERMAL CYCLING BigDye step profile 1’ 96C (hot top at 106C) 10” 96C 15x 30” 50C or Tm 1’15" 60C 10” 96C 5x 30” 50C or Tm 1’30" 60C 10” 96C 5x 30” 50C or Tm 2’00" 60C ∞ 4C 16SAr_F: PU178  5' GCACCCGCTGAAYTT 3'16SBr_R: PL1642 5' CCAGCGCCATCCATTTTCA 3‘ LCO1490 F: 5'GGTCAACAAATCATAAAGATATTGG -3’ HC02198 R: 5'TAAACTTCAGGGTGACCAAAAAATCA-3’ PCR CHEMISTRY BigDye v.3.1 (ABI) contents? [primer stock] 1.6 mmolar template 5 ml SPECIFIC MPLICON (Water)

  15. Sequencing cleanup Cleanup of sequencing reaction extension products Why Removal of unincorporated fluorescent ddNTPs (background) Removal of reaction ingredients aids downstream manipulation How Precipitation (remember how) Small nucleic acids (ddNTPs) do not precipitate as readily as extension products, removed with washing

  16. DNA SEQUENCING PCR with conserved primers, WHY? DNA PCR clean up, WHY? Amplicon (direct) sequencing, HOW? Reading extension products….. “*.ABI” Sequence analysis?

  17. Clone • 10 reactions • 4x 18S parasite (EP1) • 3x 18S parasite (EP3) • 3x 28S parasite (EP1) • Total 10 cloning reactions, need 20 LB, Kan, Xgal culture plates • Label plates with group number, source organism amplified gene,volume plated.eg: 10(EP1_18S)10, or 9(EP3_18S),100 CHECK FOR 1 HOUR

  18. DNA SEQUENCING PCR with conserved primers, WHY? DNA PCR clean up, WHY? Amplicon (direct) sequencing, HOW? Reading extension products….. “*.ABI” Sequence analysis?

  19. Win/PC MAC

  20. Template vs Coding Strands It is often useful to distinguish the two strands of DNA -- the strand that is copied into mRNA and subsequently translated has the complementary sequence to the mRNA, while the base sequence of the opposite strand directly corresponds to the codons in the mRNA. The terms template strand, sense strand, and coding strand are commonly used to describe one of the two strands of DNA, however the nomenclature is quite confusing because different authors have used these terms to describe both strands -- one school argues that the strand copied into mRNA should be considered the template strand, but the other school argues that the opposite strand which reflects the sequence in the mRNA should be considered the template because the corresponding codons are copied into protein. The first definition is used in the figures below, however, to avoid confusion, when using the words template, sense, or coding, it is essential to explicitly define how you are using the terms. I believe that these terms are best defined as described below. The term template strand refers to the sequence of DNA that is copied during the synthesis of mRNA. The opposite strand (that is, the strand with a base sequence directly corresponding to the mRNA sequence) is called the coding strand or the mRNA-like strand because the sequence corresponds to the codons that are translated into protein. http://www.sci.sdsu.edu/~smaloy/MicrobialGenetics/topics/chroms-genes-prots/temp-strand.html

  21. Forward primer sequencing reaction sequencing generates + strand ATCG ggaa 5’ 3’ dye blobs Reverse primer sequencing reaction CCTT tagc 5’ generates - strand 3’ dye blobs

  22. sequencing + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ sense GGAA A 5’ ATCG 3’ NEED TO KNOW WHY SEQUENCE THIS? A antisense CCTT 3’ TACG 5’

  23. sequencing forward + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ sense GGAA A 5’ ATCG 3’ Forward primer sequencing reaction ATCG 5’ 3’ A - strand antisense non-coding CCTT 3’ TACG 5’

  24. sequencing results + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ Forward primer sequencing reaction generates sense strand ATCG ggaa 5’ 3’ A - strand antisense non-coding CCTT 3’ TACG 5’

  25. sequencing reverse + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ sense GGAA A 5’ ATCG 3’ A antisense CCTT 3’ TACG 5’

  26. sequencing reverse + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT 5’ 3’ A antisense CCTT 3’ TACG 5’

  27. sequencing results + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT tagc 5’ generates - strand 3’

  28. sequencing results + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT tagc 5’ generates - strand 3’ ABI File generated 5’-3’ Sequence is reverse complement of coding sequence !

  29. Forward primer sequencing reaction sequencing generates + strand ATCG ggaa 5’ 3’ Reverse primer sequencing reaction CCTT tagc 5’ generates - strand 3’ sequencing generates + strand ATCG ggaa 5’ 3’ reverse complement yields + (coding) sequence two confirmatory sets of sequence data

  30. sequencing results + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT tagc 5’ generates - strand 3’ ABI File generated 5’-3’ TTCC cgat 3’ 5’ dnarts - setareneg Sequence is reverse complement of coding sequence !

  31. NANODROP QUBIT V ng/ml ng/ml ml 63.22 69.6 37 NextSeq Illumina genome sequencing NEEDs 500-1000 ng DNA for Kapa Hyper prep kit https://www.kapabiosystems.com/assets/KAPA_Hyper_Prep_Kit_TDS.pdf

  32. NextSeq Illumina run, 130 million, 2 x 150 (300nt) Paired End Reads Result: ≤ 3,900,000,000 nucleotides(inspect all nts @1/sec:/365/24/60/60 = ~123 years) Sequence quality: Trimming Filtering to remove adaptors, barcodes Assembly https://www.youtube.com/watch?annotation_id=annotation_1533942809&feature=iv&src_vid=HMyCqWhwB8E&v=fCd6B5HRaZ8

More Related