helenwilliams
Uploaded by
61 SLIDES
631 VUES
610LIKES

Unraveling Protein Synthesis: Bridging Genotype and Phenotypes

DESCRIPTION

Dive into the intricate world of protein synthesis with a review covering DNA packaging, replication, transcription, translation, and the flow of genetic information from gene to protein. Explore key topics such as Garrod and Beadle & Tatum's experiments that shaped the 'One Gene, One Enzyme' theory. Understand how DNA sequences differ in genetic disorders like sickle cell anemia and how information is transcribed, translated, and processed to create proteins. Enhance your understanding of the central dogma and the genetic code dictionary.

1 / 61

Télécharger la présentation

Unraveling Protein Synthesis: Bridging Genotype and Phenotypes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 17 Protein Synthesis

  2. A Brief Review • 1) DNA Packaging; 2) DNA Replication: http://www.hippocampus.org/HippoCampus/Biology;jsessionid=F30865A8DE688DE6D4BD68F8161E8473

  3. Overview of Transcription/Translation (in “real time”) • www.hippocampus.org is a great resource for almost every subject….not just Bio! • For this unit, especially, Transcription and Translation: http://www.hippocampus.org/HippoCampus/Biology;jsessionid=F30865A8DE688DE6D4BD68F8161E8473 • Other recommended sites and videos: http://vcell.ndsu.nodak.edu/animations/

  4. Introductory Questions #1 • Name the substance that accumulates in a person’s urine causing alkaptonuria. • Why did Beadle and Tatum use breadmold spores to determine that one gene forms one polypeptide allowing for the first metabolic pathway to be defined? • Transcribe & Translate the following sequence of DNA by determining the nucleotide sequence for mRNA, the anticodon for tRNA, and the overall amino acid sequence: TACTCAGGACCTGCAACGATT mRNA: ??????????????????????????????? Amino acids Sequence: ??????????????????????????????? Anticodon: ??????????????????????????????? • How does the DNA and amino acid sequences differ from a person with sickle cell anemia and a person with normal hemoglobin in their RBC’s? (pg. 344) • When mRNA is “processed” what is taken out (spliced)?

  5. Protein Synthesis: Chapter 17 Bridging the gap between Genotype & Phenotypes (proteins are thought to be that link) Trace the Flow of Information from Gene to Protein Key Topics: • Garrod • Beadle & Tatum • Transcription (nucleus) • Processing mRNA • Translation (cytoplasm) • Completed polypeptide (protein)

  6. Archibald Garrod (1909) • READ FROM TEXT: This is a synopsis • Main Point: First to suggest that genes dictate phenotypes through enzymes that catalyze specific chem rxns. This led to “one gene/ one enzyme” theory • Studied a rare genetic disorder: Alkaptonuria • Thought to be a recessive disorder • Tyrosine is not broken down properly into carbon dioxide and water. • An Intermediate substance: Alkapton (aka “Homogentisic acid”) accumulates in the urine turning it BLACK when exposed to air. • An enzyme was thought to be lacking • A genetic mutation was thought to be the cause “An Inborn Error of Metabolism”

  7. Garrod’s Conclusion • A mutation in a specific gene is associated with the absence of a specific enzyme. • Led to the idea of: “One Gene, One Enzyme” • Not validated until Beadle & Tatum’s work in the 1940’s with Neurospora (breadmold)

  8. George Beadle & EdwardTatum • Discovered the “One Gene, One Enzyme” Principle • Analyzed mutations that interfered with a known metabolic pathway • Organism they chose to work with: Neurospora (breadmold) -Grows easily -Grows as a haploid: (no homologs) -Mutants are easily identified: Dominant allele won’t be expressed • Neurospora can grow easily in only: salt, sugar, & Biotin (vitamin)

  9. George Beadle & EdwardTatum cont’d • Mutants-are unable to make certain organic molecules: amino acids, lipids, etc. • These substances are added to the media which will allow mutants to grow successfully • Exposed the haploid spores to x rays & UV to induce mutations • Haploid spores were crossed, grown in a variety of media to determine what kind of mutation was occurring • **They examined the effect of the mutation instead of identifying the enzyme.

  10. Beadle & Tatum Experiment w/Neurospora

  11. Beadle & Tatum’s Conclusion “One Gene affects One Enzyme” Later  Revised “One Gene affects One Protein” Later  Revised “One Gene affects One Polypeptide Chain”

  12. THE FLOW OF GENETIC INFORMATION (central dogma)DNA → RNA → PROTEIN • The information constituting an organism’s genotype is carried in its sequence of bases

  13. Protein Synthesis: overview • Transcription: synthesis of mRNA under the direction of DNA • Translation: actual synthesis of a polypeptide under the direction of mRNA

  14. Genetic Information Written in Codons isTranslated into Amino acid Sequences • The “words” of the DNA “language” are triplets of bases called codons • The codons in a gene specify the amino acid sequence of a polypeptide • Why triplets? *Remember there are 20 amino acids and only 4 bases

  15. Various Types of RNA Molecules

  16. Gene 1 Gene 3 DNA molecule Gene 2 DNA strand TRANSCRIPTION RNA Codon TRANSLATION Polypeptide Amino acid Figure 10.7

  17. 4) How many sites are present in the ribosome? Name the enzyme that is used to attach an amino acid to the tRNA molecule. • An exercise in translating the genetic code Transcribed strand DNA Transcription RNA Startcodon Stopcodon Translation Figure 10.8B Polypeptide

  18. The Genetic Code Dictionary • Virtually all organisms share the same genetic code • 1st codon determined was “UUU” by Marshal Nirenberg in 1961. • All of the codons were determined by the mid 1960’s Figure 10.8A

  19. RNA polymerase DNA of gene Promoter DNA Terminator DNA Initiation • RNA nucleotides line up along one strand of the DNA following the base-pairing rules • The single-stranded messenger RNA peels away and the DNA strands rejoin • In transcription, the DNA helix unzips Elongation Area shownin Figure 10.9A Termination GrowingRNA Completed RNA RNApolymerase Figure 10.9B

  20. Transcription • Occurs in the nucleus • RNA Polymerase is needed -Adds nucleotides to the 3’ end only -Eukaryotes have three types vs. Bacteria with only one type • Elongation occurs from 5’  3’ direction • TATA Box : initiation site for the attachment of RNA polymerase • 3 Steps: Initiation  Elongation  Termination

  21. Transcription: Initiation • RNA Polymerase binds to the “Promoter” region on the DNA (upstream about 25 nucleotides) • RNA Polymerase recognizes this region because of the “TATA” box • Other proteins also are needed: “Transcription factors”

  22. Transcription produces genetic messages in the form of RNA RNA nucleotide RNApolymerase Direction oftranscription Templatestrand of DNA Newly made RNA Figure 10.9A

  23. Transcription: Elongation • DNA is untwisted (hydrogen bonds are broken) • About 10 base pairs are exposed • Nucleotides are are added to the 3’ end of the growing mRNA molecule • Proceeds at a rate of: ~ 60 nucleotides/sec

  24. Transcription: Termination • Termination site is “signaled” and “read” by RNA Polymerase • In Eukaryotes, a polyadenylation sequence (“AAUAAA”) is transcribed about 10-35 nucleotides before the (pre)mRNA is released • Pre-mRNA molecule is made consisting of “Coded” (Exons) and “Non-coded” (Introns) regions • Note: In Bacteria, Translation can occur as it is released from the first transcription event. http://highered.mheducation.com/sites/9834092339/student_view0/chapter16/processing_of_gene_information__prokaryotes_vs__eukaryotes.html

  25. Stages of transcription

  26. Transcription- The three Phases

  27. Eukaryotic RNA is processed before leaving the nucleus Exon Intron Exon Intron Exon DNA TranscriptionAddition of cap and tail • Noncoding segments called introns are spliced out (they stay in the nucleus) • A cap and a tail are added to the ends • http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html# Cap RNAtranscriptwith capand tail Introns removed Tail Exons spliced together mRNA Coding sequence NUCLEUS CYTOPLASM Figure 10.10

  28. mRNA Structure • 1) 5’ cap: modified guanine; protection; recognition site for ribosomes • 2) 3’ tail: poly(A) tail (adenine); protection; recognition; transport • 3) RNA splicing: involves introns & Exons • Exons (expressed sequences) retained (exit the nucleus to ribosome) • Introns (intervening sequences) -These are spliced out / spliceosome -They don’t go to ribosome (stay in the nucleus)

  29. Key Regions on Newly Transcribed mRNA

  30. Splicesomes w/ SNRNP’s(Small nuclear ribonuclearprotein-aka ‘snurps’)

  31. Animated View of Transcription • http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html#

  32. Translation • Occurs in the Cytoplasm • Key molecules and structures include: • mRNA • tRNA • Ribosome (30s and 40s subunits: small and large subunits) • Free floating amino acids • Endoplasmic reticulum

  33. 3 Stages of translation • 1) Initiation • Brings together mRNA, tRNA and ribosome • Begins at the start code, AUG 2) Elongation -codon of mRNA and anticodon of tRNA complementary bond to one another -peptide bond fromation -translocation-ribosome moves to next codon 3)Termination-mRNA stop codons-UAA,UAG,UGA

  34. Translation: Overview

  35. Transfer RNA molecules serve as interpreters during translation Amino acid attachment site • In the cytoplasm, a ribosome attaches to the mRNA and translates its message into a polypeptide • The process is aided by transfer RNAs Hydrogen bond RNA polynucleotide chain Anticodon Figure 10.11A

  36. A Typical tRNA Molecule

  37. Translation: Transfer RNA (tRNA) mRNA from nucleus is ‘read’ along its codons by tRNA’s anticodons at the ribosome tRNA – has the anticodon and amino acid attached

  38. Each tRNA molecule has a triplet anticodon on one end and an amino acid attachment site on the other Amino acidattachment site Anticodon Figure 10.11B, C

  39. Attachment of an Amino Acid

  40. Ribosomes Build Polypeptides Next amino acidto be added topolypeptide Growingpolypeptide tRNA molecules P site A site Growingpolypeptide Largesubunit tRNA P A mRNA mRNAbindingsite Codons mRNA Smallsubunit Figure 10.12A-C

  41. mRNA, a specific tRNA, and the ribosome subunits assemble during initiation Largeribosomalsubunit Initiator tRNA P site A site Startcodon Small ribosomalsubunit mRNA 1 2 Figure 10.13B

  42. Elongation adds amino acids to the polypeptide chain until a stop codon terminates translation • The mRNA moves one codon at a time relative to the ribosome • A tRNA pairs with each codon, adding an amino acid to the growing polypeptide

  43. Amino acid Polypeptide Asite P site Anticodon mRNA 1 Codon recognition mRNAmovement Stopcodon Newpeptidebond 2 Peptide bond formation 3 Translocation Figure 10.14

  44. Newpeptidebondforming Growing polypeptide Stage Elongation 4 A succession of tRNAs add their amino acids to the polypeptide chain as the mRNA is moved through the ribosome, one codon at a time. Codons mRNA Polypeptide Stage Termination 5 The ribosome recognizes a stop codon. The poly-peptide is terminated and released. Stop Codon Figure 10.15 (continued)

  45. Translation- the Ribosome (2 subunits- large and small) rRNA site of mRNA codon & tRNA anticodon coupling P site holds the tRNA carrying the growing polypeptide chain A site holds the tRNA carrying the next amino acid to be added to the chain E site discharged tRNA’s

  46. Animated View of Transcription • http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter15/animations.html#

  47. Translation- Summary • Initiation ~ union of mRNA, tRNA, small ribosomal subunit; followed by large subunit • Elongation ~ •codon recognition; •peptide bond formation; •translocation • Termination ~ ‘stop’ codon reaches ‘A’ site • Polyribosomes: translation of mRNA by many ribosomes (many copies of a polypeptide very quickly)

  48. Transcription & Translation in Prokaryotes (*no nucleus) http://highered.mheducation.com/sites/9834092339/student_view0/chapter16/processing_of_gene_information__prokaryotes_vs__eukaryotes.html

  49. Introductory Questions • Transcribe & Translate the following sequence of DNA: TACTCAGGACCTGCAACGATT mRNA: ??????????????????????????????? Amino acids Sequence: Anticodon: 2) How does the DNA and amino acid sequences differ from a person with sickle cell anemia and a person with normal hemoglobin in their RBC’s? 3) When mRNA is “processed” what is taken out (spliced)? 4) How many sites are present in the ribosome? Name the enzyme that is used to attach an amino acid to the tRNA molecule.

  50. Mutations & Errors During Transcription & Translation

More Related