inge
Uploaded by
42 SLIDES
1125 VUES
450LIKES

Systemic acquired resistance

DESCRIPTION

Systemic acquired resistance. Define systemic resistance and some history Associated molecular changes Role of SA and other signaling molecules Role of NPR1 (non-expresser of pathogenesis related genes 1). Systemic acquired resistance. What do we know about systemic acquired resistance?.

1 / 42

Télécharger la présentation

Systemic acquired resistance

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Systemic acquired resistance Define systemic resistance and some history Associated molecular changes Role of SA and other signaling molecules Role of NPR1 (non-expresser of pathogenesis related genes 1)

  2. Systemic acquired resistance What do we know about systemic acquired resistance?

  3. Systemic acquired resistance Systemic acquired resistance was first recognized as a significant phenomenon in the early 1900s. At that time, it was recognized that infection of plants with “necrotizing” pathogens (causing HR) often results in enhanced resistance to subsequent infections by a variety of fungal, bacterial and viral pathogens. This physiological immunity was termed systemic acquired resistance (SAR). SAR confers a broad spectrum type of resistance SAR is effective against some but not all pathogens: Tobacco: Phytophthora parasitica, Cercospora nicotianae, Peronospora tabacina tobacco mosaic virus, tobacco necrosis virus, Pseudomonas syringae pv. tabaci, Erwinia carotovora Not effective against: Botrytis cinerea or Alternaria alternata Arabidopsis: Phytophthora parasitica turnip crinkle virus Pseudomonas syringae pv. tomato DC3000

  4. Some key events in understanding regulation of SAR Systemic acquired resistance was associated with the coordinated induction of a set of SAR genes encoding proteins known as Pathogenesis-related (PR) proteins (Van Loon and Gianinazzi (early 1970s). (1979) White found that acetyl salicylic acid application sufficient to induce PR gene expression and enhanced resistance to tobacco mosaic virus in tobacco plant. Discovery came out the interest in developing chemical control methods for viral infection. After that several groups went on to show that salicylic acid application on tobacco leaves mimics pathogen induced expression of PR genes and pathogen resistance in treated tissues. (1990) Two groups one led by Klessig and Raskin and another led by Metraux found that salicylic acid accumulates in cucumber and tobacco plants prior to pathogen infection, but before the onset of resistance. The work by these and many others led to the hypothesis that salicylic acid (SA) is the endogenous signal molecule that is required for the induction of systemic acquired resistance. (1993/1994) The group headed by Ryals made tobacco plants that could not accumulate SA and found that these plants were defective in their ability to develop systemic acquired resistance. This work demonstrated a central role for SA in establishing systemic acquired resistance. The group also demonstrated that these tobacco plants were defective in their ability to accumulate PR proteins. (1997) Cloning of NPR1, a key regulator of SAR

  5. PR (Pathogenesis-Related) proteins PR proteins first identified as major proteins induced by necrotizing pathogens (pathogens that induced the hypersensitive response) • Proteins secreted predominantly into intercellular spaces in response to wounding or infection. • Soluble at pH 3 • Basic homologs also found (in vacuole). • Proteinase resistant (but not proteinase inhibitors). • Some are developmentally expressed as part of normal plant development in absence of wound or infection (e.g. flowering).

  6. Traditional PR protein gels Acidic gel Basic gel PR proteins Proteins first isolatedfrom apoplast ofTMV-infected tobacco. Induced by many other pathogens. Some PR proteins are also induced byabiotic stresses. old nomenclature All tobaccoPR proteins

  7. PR genes induced after HR or SA treatment

  8. What do PR proteins do? Sels et al. (2008) Plant Physiol. Biochem. 46:941-950 Also van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162

  9. Some are members of large gene families – e.g. PR-1 van Loon et al. (2006) Annu. Rev. Phytopathol. 44:135-162

  10. Control Line 373 230 238 329 373 548 18 days after growth in R. solani-laden sand 11 d.a.g. in R. solani sand Constitutive expression of chitinase PR protein confersresistance to Rhizoctonia solani Brogue et al. (1991) Science 254, 1194-1196

  11. Application of salicylic acid mimics SAR (1979) White found that the application of aspirin, salicylic acid, and benzoic acid resulted in enhanced resistance to TMV. Used 3 tobacco cultivars that contained the N resistance gene that confers HR to TMV. Found > 90% reduction in lesion number in treated leaves versus water control.

  12. SA accumulation is associated with acquisition of resistance SA Lesions obtained after second inoculation

  13. Science (1993) 261, 754-756.

  14. Central role of SA in SAR PR-1 PR-2 PR-3 PR-1 mRNA

  15. Central role for SA in defense continued

  16. Enhanced susceptibility Loss of resistance INA induces resistance in presence of nahG

  17. What is the mobile systemic signal(s) for SAR? Methylsalicylate – meSA SABP2 (meSA esterase) is required for SAR Park et al. Science 318:113-116

  18. What is the mobile systemic signal(s) for SAR? Methylsalicylate – meSA SAMT1 (SA methyltransferase) is required for SAR Park et al. Science 318:113-116

  19. What is the mobile systemic signal(s) for SAR? Methylsalicylate – meSA meSA induces SAR in systemic tissues expressing SABP2 (MeSA esterase) Park et al. Science 318:113-116

  20. A role of glycerol-3-phosphate in SAR Reduced SAR in gly1 and gli1 mutants G3P levels increase in response to pathogen in local and systemic tissues Chanda et al. (2011) Nat. Genet. 43:421-427

  21. A role of glycerol-3-phosphate in SAR Exogenous G3P restores SAR in gli1 and gly1 plants Chanda et al. (2011) Nat. Genet. 43:421-427

  22. G3P conferred SAR is dependent on DIR1 DIR1 is a proposed lipid transporter protein DIR1 is needed for G3P transport Chanda et al. (2011) Nat. Genet. 43:421-427

  23. The Arabidopsis NPR1 Gene That Controls Systemic Acquired Resistance Encodes a Novel Protein Containing Ankyrin Repeats Hui Cao, Jane Glazebrook,Joseph D. Clarke, Sigrid Volko,and Xinnian Dong (1997) Cell 88, 57–63, Signaling steps between SA and PR protein expressionand disease resistance. • Previously: Linked a PR protein promoter called BGL2 to GUS. • Screened thousands of mutant transgenic BGL2-GUS plants forABSENCE of GUS activity induced by SA treatment. • Using standard Arabidopsis genetic mapping methods, identified asingle mutant gene, npr1. Phenotype: • Complete absence of GUS activity in response to SA • Absence of PR-1, PR-5, BGL2 expression in response to SA • Is now susceptible to Peronospora parasitica and to • Pseudomonas syringae pv maculicola (Psm). Cao et al. (1997) Cell 88, 57–63,

  24. genotype: wt npr1-2 Cloned NPR1 by standard 1990’s methods. Chromosome walking, YAC library… non-compl. transgene: none none NPR1 NPR1 Proof of cloning by transgenic comple-mentation of mutants w/ wildtype NPR1. wt npr1-1 + NPR1 npr1-1 symptoms Psm inoculated GUS Cao et al. (1997) Cell 88, 57–63,

  25. NPR1 has ankyrin repeats Ankyrin repeats arein lots of differentproteins. Involved in protein-protein interactions. Especially in proteinsthat control trans-cription. In NF-kB and I-kB inmammals. Inducedby many pathogens, stresses… Cao et al. (1997) Cell 88, 57–63,

  26. NPR1 is reduced to a monomer during plant defense Mou et al., (2003) Cell, 113:935–944

  27. Expression of PR-1 is associated with NPR1 monomerization Mou et al., (2003) Cell, 113:935–944

  28. Monomeric NPR1 localizes to the nucleus Mou et al., (2003) Cell, 113:935–944

  29. NPR1 interacts with TGA transcription factors in yeast two-hybrid assays TGA transcription factors bind to TGACG sequences found in the promoter of genes such as PR-1 Zhou et al. (2000) MPMI 13:191–202

  30. NPR1 enhances TGA1 binding to the as-1 element under reducing conditions Despres et al. (2003) Plant Cell. 15:2181–2191,

  31. WRKY transcription factors: another key group of transcription factors that regulate plant defense responses • Recognize the motif: (T)(T)TGAC(C/T). • Have the conserved WRKYGQK at N-terminal end. • Have a novel zinc-finger-like motif. • Bind DNA via divalent cation (probably zinc). • Approx. 100 members of WRKY family in Arabidopsis. • NPR1 has a WRKY motif in its promoter: TTGACTTGACTTGGCTCTGCTCGTCAA The WRKY superfamily of plant transcription factors Thomas Eulgem, Paul J. Rushton, Silke Robatzek and Imre E. Somssich (2000) Trends Plant Sci 5, 199-205.

  32. Conserved amino acidsin WRKY proteins ofArabidopsis (red). Putative Zn-finger ligandsare highlighted in black. Eulgem et al. (2000) TIPS 5, 199-205.

  33. Identification of direct transcriptional targets of NPR1 WRKY54, WRKY38, WRKY59, WRKY18, WRKY70, WRKY66, and WRKY53 are induced directly by NPR1. Wang et al. (2006) PLoS Pathogens 2:1042-1050

  34. Evidence that WRKY58 negatively regulates plant defense Wang et al. (2006) PLoS Pathogens 2:1042-1050

  35. WRKY70 and 54 negatively regulate SA biosynthesis and positively regulate SAR Wang et al. (2006) PLoS Pathogens 2:1042-1050

  36. Identification and Cloning of a Negative Regulator of Systemic Acquired Resistance, SNI1, through a Screen for Suppressors of npr1-1 Xin Li, Yuelin Zhang, Joseph D. Clarke, Yan Li,† and Xinnian Dong* Cell, 98, 329–339, 1999. Screened for EMS mutants of npr1-1 plants containing BGL2-GUSreporter. Look for plants that turn blue in response to INA (SA analog) like NPR1 wild type plants. But which, of course still harbor the npr1-1 mutation. Found 11 loci that gave increased GUS, out of 7000 plants screened. Li et al., Cell 98, 329–339.

  37. Li et al., Cell 98, 329–339.

  38. Li et al., Cell 98, 329–339.

  39. SNI1 is similar to mouse Retinoblastoma (Rb). Rb is a tumor suppressor that represses function of E2F transcription factor 93-95% of genes upregulated in sni1 mutants are induced by BTH Li et al., Cell 98, 329–339.

  40. SNI1 represses transcription in yeast sni1 mutation alters gene expression – most genes also induced by BTH Mosher et al. (2006) Plant Cell, 18:1750–1765

  41. Chromatin modifications at the PR-1 promoter in sni1 mutants Mosher et al. (2006) Plant Cell, 18:1750–1765

  42. Dynamics of NPR1 protein Mukhtar et al. 2009 Cell. 137:804-806

More Related