1 / 4

DNA Analysis from Crime Scene and Suspects Using Restriction Enzymes

This document details the examination of DNA samples collected from a crime scene using two enzymes—Enzyme 1 and Enzyme 2—alongside DNA from two suspects. Utilizing restriction enzymes BamHI and HaeIII, the DNA is cut at specific locations based on unique base sequences known as restriction sites. The analysis compares the profiles of the crime scene DNA against the profiles from the suspects, which may provide crucial evidence in solving the case.

ingrid-palmer
Télécharger la présentation

DNA Analysis from Crime Scene and Suspects Using Restriction Enzymes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A B C D E F

  2. DNA Sample Key • A: DNA from crime scene with Enzyme 1 • B: DNA from crime scene with Enzyme 2 • C: DNA from suspect 1 with Enzyme 1 • D: DNA from suspect 1 with Enzyme 2 • E:DNA from suspect 2 with Enzyme 1 • F: DNA from suspect 2 with Enzyme 2

  3. Restriction Enzymes • Cut DNA in at specific location based on base sequences called restriction sites Bam HI ATGCGTGGCCGTACTACCCATGGATCCGGGTATATAG TACGCACCGGCATGATGGGTACCTAGGCCCATATATC ↓ 5’-GGATCC-3’ 3’-CCTAGG-5’ ↑ ↓ ↑

  4. Restriction Enzyme II: HaeIII ↓ 5’-GGCC-3’ 3’-CCGG-5’ ATGCGTGGCCGTACTACCCATGGATCCGGGTATATAG TACGCACCGGCATGATGGGTACCTAGGCCCATATATC ↑ ↓ ↑

More Related