jalila
Uploaded by
52 SLIDES
1376 VUES
560LIKES

Nucleic Acids

DESCRIPTION

Nucleic Acids. Nucleic Acids Structures of Nucleic Acids DNA Replication RNA and Transcription. Nucleic Acids - RNA and DNA. is a complex, high-molecular-weight biochemical macromolecule composed of chains that convey genetic information.

1 / 52

Télécharger la présentation

Nucleic Acids

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Nucleic Acids Nucleic Acids Structures of Nucleic Acids DNA Replication RNA and Transcription

  2. Nucleic Acids - RNA and DNA is a complex, high-molecular-weight biochemical macromolecule composed of chains that convey genetic information. The most common nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). Nucleic acids are found in all living cells and viruses.

  3. Nucleotides Nucleic acids consist of nucleotides that have a sugar, nitrogen base, and phosphate nucleoside Base PO4 Sugar

  4. Nucleotides • are the building blocks of DNA and RNA. • Serve as molecules to store energy and reducing power. • The three major components in all nucleotides are phosphoric acid, pentose (ribose and deoxyribose), and a base (purine or purimidine). • Two major purines present in nucleotides are adenine (A) and guanine (G), and three major purimidines are thymine (T), cytosine (C) and uracil (U).

  5. Ribonucleotides • Adenosine triphosphate (ATP) and guanosine triphosphate (GTP), which are the major sources of energy for cell work. - The phosphate bonds in ATP and GTP are high-energy bonds. - The formation of phosphate bonds or their hydrolysis is the primary means by which cellular energy is stored or used. • nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP). The two most common carriers of reducing power for biological oxidation-reduction reactions.

  6. Deoxyribonucleic Acid (DNA) Deoxyribonucleic acid (DNA) is formed by condensation of . 3 The nucleotides are linked together between the 3’ and 5’ carbons’ successive pentose rings by pr bonds 5

  7. Deoxyribonucleic Acid (DNA) • DNA is a very large threadlike macromolecule (MW, 2X109 D in E. coli). • DNA contains adenine (A) and guanine (G), thymine (T) and cytosine (C). • DNA molecules are two stranded and have a double-helical three-dimensional structure.

  8. DNA Double-helical Structure

  9. Double Helical DNA Structure The main features of double helical DNA structure are as follows: . • The phosphate and deoxyribose units are on the outer surface, but the bases point toward the chain center. The plane of the bases are perpendicular to the helix axis. - The diameter of the helix is 2 nm, the helical structure repeats after ten residues on each chain, at an interval of 3.4 nm. • The two chains are held together by hydrogen bonding between pairs of bases. Adenine (A) - ,guanines (G) - . - The sequence of bases along a DNA strand is not restricted in any way and carries genetic information, and sugar and phosphate groups perform a structure role.

  10. DNA Replication Regeneration of DNA from original DNA segments. http://highered.mcgraw-hill.com/sites/0072437316/student_view0/chapter14/animations.html#

  11. DNA Replication • DNA helix unzips and forms two separate strands. • Each strand will form a new double strands. • The two resulting double strands are identical, and each of them consists of one original and one newly synthesized strand. - This is called semiconservative replication. • The base sequences of the new strand are complementary to that of the parent strand.

  12. Ribonucleic Acid (RNA) • Ribonucleic acid (RNA) is formed by condensation of . • RNA is a long, unbranched macromolecule and may contain 70 to several thousand nucleotides. RNA molecule is usually single stranded. • RNA contains adenine (A), guanine (G), cytosine (C) and uracial (U). A-U, G-C in some double helical regions of t-RNA.

  13. Classification of RNA According to the function of RNA, it can be classified as: • RNA: (m-RNA) synthesized on chromosome and carries genetic information to the ribosomes for protein synthesis. It has short half-life. • RNA (t-RNA) is a relatively small and stable molecule that carries a specific amino acid from the cytoplasm to the site of protein synthesis on ribosomes. • RNA (r-RNA) is the major component of ribosomes, constituting nearly 65%. r-RNA is responsible for protein synthesis. • Ribozymes are RNA molecules that have catalytic properties.

  14. Summary of Nucleic Acids Nucleotides are basic units of nucleic acids DNA and RNA. • Nucleotides include pentose, base and phosphoric acid. • Bases include purine or pyrimidine. • Two major purines present in nucleotides are adenine (A) and guanine (G), and three major pyrimidines are thymine (T), cytosine (C) and uracil (U). • Ribonucleotides - adenine triphosphate (ATP) stores energy. - NAD and NADP are important carriers of reducing power.

  15. Summary of Nucleic Acids DNA • DNA contains genetic information. • DNA contains adenine (A) and guanine (G), and thymine (T), and cytosine (C). A-T G-C • DNA has a double helical structure. • The bases in DNA carry the genetic information.

  16. Summary of Nucleic Acids • RNA • RNA functions as genetic information-carrying intermediates in protein synthesis. • It contains adenine (A) and guanine (G), and cytosine (C) and uracil (U). • m-RNA carries genetic information from DNA to the ribosomes for protein synthesis. • t-RNA transfers amino acid to the site of protein synthesis • r-RNA is for protein synthesis.

  17. Summary of Cell Construction

  18. Nucleic Acid Chemistry Where the info is…interpreting the blueprint

  19. Central Dogma DNA ---------------- RNA-------------- protein Replication transcription translation

  20. Central Dogma • Replication • DNA making a copy of itself • Making a replica • Transcription • DNA being made into RNA • Still in nucleotide language • Translation • RNA being made into protein • Change to amino acid language

  21. Replication • Remember that DNA is self complementary • Replication is semiconservative • One strand goes to next generation • Other is new • Each strand is a template for the other • If one strand is 5’ AGCT 3’ • Other is: 3’ TCGA 5’

  22. Replica • Write the strand complementary to: 3’ ACTAGCCTAAGTCG 5’ Answer

  23. Replication is Semiconservative

  24. Replication • Roles of enzymes • Topoisomerases • Helicase • DNA polymerases • ligase • DNA binding proteins • DNA synthesis • Leading strand • Lagging strand

  25. Replication

  26. Replication • Helix opens • Helicase • Causes supercoiling upstream • Topoisomerases (gyrase) • DNA Binding Proteins • Prevent reannealing

  27. Replication

  28. Replication • Leading strand • 3’ end of template • As opens up, DNA polymerase binds • Makes new DNA 5’ - 3’ • Same direction as opening of helix • Made continuously

  29. Replication

  30. Replication • Lagging strand • 5’ end of template • Can’t be made continuously as direction is wrong • RNA primer • New DNA made 5’  3’ • Opposite direction of replication • Discontinuous • Okazaki fragments • Ligase closes gaps

  31. Transcription • DNA template made into RNA copy • Uracil instead of Thymine • One DNA strand is template • Sense strand • Other is just for replication • Antisense (not to be confused with nonsense!) • In nucleus • nucleoli

  32. Transcription • From following DNA strand, determine RNA sequence 3’ GCCTAAGCTCA 5’ Answer

  33. Transcription

  34. Transcription • DNA opens up • Enzymes? • RNA polymerase binds • Which strand? • Using DNA template, makes RNA • 5’-3’ • Raw transcript called hnRNA

  35. Transcription How does RNA polymerase know where to start? upstream promotor sequences Pribnow Box TATA box RNA polymerase starts transcription X nucleotides downstream of TATA box

  36. Introns and Exons • Introns • Intervening sequences • Not all DNA codes for protein • Regulatory info, “junk DNA” • Exons • Code for protein

  37. Processing of hnRNA into mRNA • 3 steps • Introns removed • Self splicing • 5’ methyl guanosine cap added • Poly A tail added • Moved to cytosol for translation

  38. Processing of hnRNA into mRNA

  39. Translation • RNA -- Protein • Change from nucleotide language to amino acid language • On ribosomes • Vectorial nature preserved • 5’ end of mRNA becomes amino terminus of protein • Translation depends on genetic code

  40. Genetic Code • Nucleotides read in triplet “codons” • 5’ - 3’ • Each codon translates to an amino acid • 64 possible codons • 3 positions and 4 possiblities (AGCU) makes 43 or 64 possibilities • Degeneracy or redundancy of code • Only 20 amino acids • Implications for mutations

  41. Genetic Code

  42. Genetic Code • Not everything translated • AUG is start codon • Find the start codon • Also are stop codons • To determine aa sequence • Find start codon • Read in threes • Continue to stop codon

  43. Translation • Steps: • Find start codon (AUG) • After start codon, read codons, in threes • Use genetic code to translate Translate the following: GCAGUCAUGGGUAGGGAGGCAACCUGAACCGAC Answer

  44. Translation Process • Requires Ribosomes, rRNA, tRNA and, of course, mRNA • Ribosome • Made of protein and rRNA • 2 subunits • Has internal sites for 2 transfer RNA molecules

  45. Ribosome Left is cartoon diagramRight is actual picture

  46. Transfer RNA • Mostly double stranded • Folds back on itself • Several loops • Anticodon loop • Has complementary nucleotides to codons • 3’ end where aa attach

  47. Transfer RNA

  48. Translation • Initiation • Ribosomal subunits assemble on mRNA • rRNA aids in binding of mRNA • Elongation • tRNAs with appropriate anticodon loops bind to complex • have aa attached (done by other enzymes) • Amino acids transfer form tRNA 2 to tRNA 1 • Process repeats • Termination • tRNA with stop codon binds into ribosome • No aa attached to tRNA • Complex falls apart

  49. Translation

More Related