Brown iGEM
Brown iGEM. international genetically engineered machines competition. July Update. 1/86. What is iGEM?. Biology Engineering Standardization. 2/86. Making it easier to engineer biology. 3/86. DNA is a language:. AATGAATATCCAGATCG. 4/86. Biological Part:. Promoter. 5/86.
Brown iGEM
E N D
Presentation Transcript
Brown iGEM international genetically engineered machines competition July Update 1/86
What is iGEM? • Biology • Engineering • Standardization 2/86
DNA is a language: AATGAATATCCAGATCG 4/86
Biological Part: Promoter 5/86
Different Parts connect together --- --- --- --- Promoter Gene Terminator This is a device 6/86
Different Parts connect together --- --- --- --- ConstitutivePromoter GFP Terminator This is a device 7/86
Biological parts are building blocks made of genetic material 8/86
Science • Systematic engineering • Standardizing biology • Apply biological technology 9/86
Brown iGEM Two projects being built with biological parts • Lead-detector • Tri-stable Switch 10/86
Lead Detector 11/86
Version 1.0: Lead Detector Fluorescent Protein Lead Promoter Problem: Only one cell will light up! 12/86
Version 1.1: Amplify the Signal Fluorescent Protein Amplifier Lead Promoter Problem: Promoter Leakiness = False Positives! 13/86
Version 1.2: Filter False Positives • Three Possible Solutions: • Modify the Promoter (weaker baseline) • Tight intermediate promoter (T7) • 3. Make amplifier less sensitive (increase threshold) 14/86
Final Version: The System Fluorescent Protein Leakiness Filter Amplifier Lead Promoter 15/86
NO LEAD PbrR LuxR TetR (always on) Transcription factors are constitutively made by the first promoter. LuxI Lead Promoter These proteins are poised to activate the Lead Detector promoter and Message Receiver promoter upon addition of lead. LuxI GFP pLux 17/86
PbrR LuxR TetR (always on) LuxI Lead turns on Detector promoter Lead Promoter + LuxI GFP pLux Fluorescent Protein Output 18/86
Experimental Design iGEM’s more than just design. This will take some lab work. 19/86
Experimental Design Three Independent System Components AHL unifies three components with a common language to match Inputs with Outputs. Filter Amplifier Lead Receptor and Promoter 20/86
Experimental Design Three Independent System Components AHL unifies three components with a common language to match Inputs with Outputs. Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b Filter Amplifier Lead Receptor and Promoter STEP 3 21/86
What is AHL? Why and How do we measure it? Cell Signaling Molecule Common input and output of different devices within our system Acyl Homoserine Lactone 22/86
AHL BioAssay 23/86
AHL BioAssay More AHL --> More GFP Need more than 10 nM AHL to overcome threshold 24/86
Experimental Design Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b Amplifier Lead Receptor and Promoter Filter STEP 3 25/86
Amplifier • Chemical Transformation • Electroporation • Ordering from MIT • Build it ourselves • Measure AHL output 26/86
Experimental Design Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b Amplifier Lead Receptor and Promoter Filter STEP 3 27/86
Ralstonia Metallidurans CH34 Survives in metallic environments. Lead Receptor and Promoter http://genome.jgi-psf.org/finished_microbes/ralme/ralme.home.html 28/86
Lead Receptor and Promoter We chose to examine: • Lead Receptor Protein PbrR691 2. Corresponding Lead Promoter PbrR691 Lead Promoter 29/86
Lead Receptor and Promoter • Why? • Incredibly Selective! • Novel • Successfully cloned into E Coli. Chen, Peng, Bill Greenberg, Safiyah Taghavi, Christine Romano, Daniel van der Lelie, and Chuan He. “An Exceptionally Selective Lead(II)-Regulatory Protein from Ralstonia Metallidurans: Development of a Fluorescent Lead(II) Probe.” Angew. Chem. Int. Ed. 2005, 44, 2-6. 30/86
Original Design PbrR691 PbrR691 pTet (Constitutive On) Amplifier Lead Promoter 31/86
Lead Receptor PbrR691 and Lead Promoter must be BioBricked! PbrR691 GACTGATCGATAGATCGAGATCGATCGATAGAGGCTCTCGAGATCGCGAGATATCG 32/86
BioBrick Assembly 33/86
How do we get PbrR691 and Lead Promoter? PCR 2 Major Obstacles: - Biobricking a promoter adds extra bases from the restriction sites to the ends, which may reduce promoter efficiency. - Length of promoter – very small 34/86
Experimental Plan • Purpose: Match switch components • PCR 12 variations of promoter and gene • Ligate to RBS-LuxI-GFP-Term • Test with AHL against AHL bioassay curve • Result: promoter output = amplifier input 35/86
Experimental Design Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b Amplifier Lead Receptor and Promoter Filter STEP 3 36/86
Problem: Leakiness • What if the baseline is too high? • Possible solution: T7 promoter control • Advantage: strong repression (not leaky) unless T7 RNA polymerase is present 37/86
T7 Filter Schematic T7 polymerase T7 polymerase will transcribe LuxI pPbr Amplifier LuxI T7 Promoter 38/86
Possible Issues • Poor sensitivity • Poor pPbr induction • Solution: Need to test pPbr promoter as well as whole T7 system • What are our choices for T7 systems? 39/86
T7 registry parts 40/86
Experimental Design Develop AHL Assay for testing all components. STEP 1 STEP 2a and 2b Amplifier Lead Receptor and Promoter Filter STEP 3 41/86
Tri-Stable Switch 42/86
Tristable Switch Team Introduction System Design Modeling System Tests 5. Labwork 43/86
Introduction A B • Stable Switch: A system with 2 or more distinct and inducible states. 44/86 Introduction > System Design > Modeling > System Tests > Labwork
Bistable Switch • This is the simplest switch. • It only involves two separate states. 45/86 Introduction > System Design > Modeling > System Tests > Labwork
Uses for a Bistable Switch • Drug Delivery • Simple Logic 46/86 Introduction > System Design > Modeling > System Tests > Labwork
Bistable Switch • In 2000, three scientists at Boston University managed to create a synthetic Bistable Switch. • They showed that you could create the Bistable Switch using relatively simple, standard parts. 47/86 Introduction > System Design > Modeling > System Tests > Labwork
Bistable Switch Design • The Bistable Switch simply consists of two pathways, each of which represses the other. Pathway A GFP pTet LacI Pathway B pLac TetR YFP 48/86 Introduction > System Design > Modeling > System Tests > Labwork
Importance of Bistable Switch • The Bistable Switch is one of the seminal achievements of Synthetic Biology. • It was one of the first projects that showed that you could combine standard genetic parts together to form working circuits. 49/86 Introduction > System Design > Modeling > System Tests > Labwork
Tristable Switch A B C • A switch with three distinct inducible states. 50/86 Introduction > System Design > Modeling > System Tests > Labwork