1 / 46

Conservation of Green Sea Turtles through Genetics and Genomics

This presentation discusses the conservation efforts for Green Sea Turtles in Israel, focusing on the use of genetics and genomics to understand their population dynamics and genetic variability. It also explores the potential of the Sea Turtle Genome project for further research and conservation initiatives.

jzuniga
Télécharger la présentation

Conservation of Green Sea Turtles through Genetics and Genomics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Sch l of Marine Sciences Conservation of Green Sea Turtles through Genetics and Genomics Dr. Yaron Tikochinski June - 24 - 2014 Mikhmoret marina

  2. Green Sea Turtles in Israel:On the verge of extinction About 10 nesting females along the Israeli shore (about 200 Km)

  3. About Sea Turtles: • Philopatric

  4. About Sea Turtles: • polyandry

  5. The Sea Turtle Rescue Center • Locate • Heal • Release

  6. Sea Turtles Rescue Center:Save and Heal

  7. Sea Turtles Rescue Center: Feed and Bread

  8. Let’s Increase the Numbers “I can make my own people” Jerry Seinfeld

  9. Breeding Stock

  10. The Sea Turtle Rescue Center Chelonia mydas

  11. A Large Variable Population “Population with no Variation will not survive Evolution” C. T. Urtle

  12. A Stable, Strong Population “My boys can swim!” George Costanza (marine biologist)

  13. Genetic Variability of Green Turtles Chelonia mydas • Mitochondrial DNA D-Loop • 600bp at the 5’ • 70 haplotypes worldwide • All Mediterranean (but 2) CM-A13 • Genomic STR’s show variability

  14. Genomic STR’s Chelonia mydas • Genomic STR’s show variability • Difficult to analyze – can’t tell a mother’s genotype by her offspring • Back to mtDNA? • Longer Fragments?

  15. The Mitochondrial D-loop ACACAGGAATAAAAGTGTCCACACAAACTAACTACCTAAATTCTCTGCCGTGCCCAACAGAACAATACCC GCAATACCTATCTATGTATTATTGTACATCTACTTATTTACCAATAGCATATGACCAGTAATGTTAACAG TTGATTTGGCCCTAAACATAAAAAATCATTGAATTTACATAAATATTTTAACAACATGAATATTAAGCAG AGGATTAAAAGTGAAATGACATAGGACATAAAATTAAACTATTATACTCAACCATGAATATCGTCACAGT AATTGGTTATTTCCTAAATAGCTATTCACGAGAAATAAGCAACCCTTGTTAGTAAGATACAACATTACCA GTTTCAAGCCCATTCAGTCTGTGGCGTACATAATTTGATCTATTCTGGCCTCTGGTTAGTTTTTCAGGCA CATACAAGTAACGACGTTCATTCGTTCCCCTTTAAAAGGCCTTTGGTTGAATGAGTTCTATACATTAAAT TTATAACCTGGCATACGGTAGTTTTACTTGCATATAGTAGTTTTTTTTCTCTCTGTGTTCTCAGGCCCAC ATAACTGATACCTGCCGATTCAGTGAAACTGGACTTACGTTTAAATATGATTGGCCGTGCAAACTGATTA ATGGTATTATTAAGTTAATGCTTATAAGACATAGAATTTCACAATTAAACCTAAACAATGATCTACAACC TAACTCATTATTAACTGTACTTTTTAGCTAAACCCCCCTACCCCCGTTAAAGTCAACACCAGCCCGCTAT AGCCATTTACTTCTCGCCAAACCCCTAAATCCGAGACTGACCAAACTGACATAATATCAACTGCATAAGC ATCACACAAATCAATAGGATACTTACACTAATATTTAAAAAGTACTATACAATTCAAAACACCTCTACCA CACCTCAACCAATATATATATATATTATACATTATATATATATATATATTATATATATTATATATATAAT AT Chelonia mydas

  16. DNA Repeats – a Source for Polymorphism Chelonia mydas • Mutations’ hot spots • Evolutionary shortcuts

  17. Polymorphism Emerging The mitochondrial D-loop: PCR with fluorescent primers. The 3’ end has length polymorphism: 115, 117, 119, 121, 123, 125, 127 bp

  18. AT Repeats - Aligned STR 1 STR 2 STR 3 STR 4

  19. New Haplotyping • 34 Haplotypes (+1) (mostly non-Israeli) • Can we use them? • Polymorphic • Reliable • Reproducible • Kinship

  20. Mediterranean/Israeli Green Turtles Tree

  21. Mediterranean/Israeli Green Turtles Tree

  22. Does it Tell a True Story? • DNA never lies • Scientists should always doubt

  23. Analysis Israeli Other 69 125

  24. Mediterranean Green Turtles New Haplotyping

  25. Mediterranean Green Turtles Satellite Tracking Broderick et al., 2007

  26. Mediterranean Green Turtles Satellite Tracking Rees et al., 2008

  27. Can We Use This Storyteller Outside the Mediterranean? Atlantic – same pattern Pacific - ?

  28. Genetic Variability of Indo-Pacific Green Turtles

  29. Repeats in Other Sea Turtles Loggerhead: ATATT Conventional: 3 Haplotypes Repeat Haplotyping: 48-108 repeats 30 Haplotypes (250 turtles)

  30. Repeats in Other Sea Turtles Hawksbill: CATATATAT Conventional: ? Haplotypes Repeat Haplotyping: 10,23,30 repeats 3 Haplotypes (8 turtles)

  31. Repeats in Other Sea Turtles Olive Ridley: ATATT and ATATTATT

  32. Defining Aims Why do we look at the DNA? Conservation of Biodiversity

  33. Defining Aims Sea turtles need our help in order to survive as species A stable population needs genetic variation

  34. Defining Aims We look at DNA in order to evaluate genetic polymorphism 500bp +300bp +STR’s (genomic and mitochondrial) This is just a glimpse!

  35. Our Initiative – Sea Turtle Genome www.seaturtlegenome.com

  36. Sea Turtle Genome - Status We have completed 2X coverage BGI(China) Published the genome We are starting a transcriptome We look for collaborators

  37. What Can We Do With the Sea Turtle Genome A lot: Easily find polymorphic sites (STR’s) Genes Traits Genes Diseases Gene expression

  38. Population Studies Variability Variability Variability Mitochondrial D-loop Short Tandem Repeats

  39. Library construction for STRs Extract Digest Clone Find STRs Screen Population Can we do it better?

  40. The Alternative Rational: One individual will show population polymorphism

  41. The Alternative 2x Genome of 1 specimen Isolate all STR Locate site specific pairs Isolate heterozygote sites

  42. The Algorithm

  43. Primer design

  44. Thank you for your attention

  45. Looking beyond the horizon Sch l of Marine Sciences Thanks: Yaniv Levy Yakup Kaska Adi Barash Lucy Wright Raphael Bendelac Prof. Brendan Godley Alon Daya Annette Broderick Adam Friedmann Andreas Demetropoulos Uzi Motro Marina Friling Genome Project: Renanel Pickholtz Jeremy Edwards Thank you

More Related