1 / 23

Talking Genomics: The Basic Vocabulary

Talking Genomics: The Basic Vocabulary. Genome : Mass of hereditary information essential to proper development of all living organisms Genetics : functioning and composition of single genes

karma
Télécharger la présentation

Talking Genomics: The Basic Vocabulary

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Talking Genomics: The Basic Vocabulary • Genome: Mass of hereditary information essential to proper development of all living organisms • Genetics: functioning and composition of single genes • Genomics: studies all genes and the inter-relationships to ID influence on the growth and development of the whole organism • Genomic Science: Systematic mapping interactions between 20-25K genes and their environment(s) • DNA: A macromolecule encoding the genetic instructions for the development and functioning of all known living organisms. Human Genomic Landscape Circa 2012

  2. Human Genomic Landscape Circa 2012

  3. Protein Biosynthesis The coded (Exon) genetic information—hardwired into DNA as “triplet “codons” of A,T,C, an G nucleotides—is transcribed into transportable molecules of messenger RNA (mRNA), each of which contains the program for translation into a particular protein comprised of a series of amino acids (polypeptides). Human Genomic Landscape Circa 2012

  4. ~3,000 bp (0.0001%) of Human Genome Sequences of A,T, G, and Cs which comprise the 3 billion base pairs of human DNA TGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCAGAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGCGCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTGCGGAGTAGGGGTGGGTGGGGGGAATTGGAAGCA Human Genomic Landscape Circa 2012

  5. ~23 Years Ago October 1990 Human Genome Project Begins Human Genome Project Human Genomic Landscape Circa 2012

  6. The Press Moment: “Genomic science will have a real impact on all our lives and even more on the lives of our children. It will revolutionize the diagnosis, prevention, and treatment of most, if not all, human diseases.” Bill Clinton, June 2000 Human Genomic Landscape Circa 2012 June 2000Draft Human Genome Sequence Announced

  7. “The Scientific” Moment • February 2001 • Draft Human Genome (Incomplete) Sequence Published Human Genomic Landscape Circa 2012

  8. ~10 Years Ago April 2003 Human Genome Project Ends Human Genomic Landscape Circa 2012

  9. Genomic Medicine Human Genomic Landscape Circa 2012 Healthcare tailored to individual based on genomic information

  10. Five Steps to the Realization of Genomic Medicine Human Genomic Landscape Circa 2012 Interpreting the human genome sequence Understanding a patient’s DNA sequence The development of deep catalogues of human variants across human chromosomes and get a fix on where/how those variants play a role in human disease The need for routine whole genome sequencing Getting all this data in a useable form

  11. Step #2: Understanding a Patient’s DNA Sequence: The Encode Project:To understand how genetic variations affect human traits and diseases Human Genomic Landscape Circa 2012

  12. Step #3. Developing Deep Catalogues of Human Variants (Alternative forms of genes or “Single Nucleotide Polymorphisms, SNPs) Human Genomic Landscape Circa 2012

  13. HapMap ProjectID common patterns of human genome variation and relationship to (rare and complex) human disease • Variants clustered together and inherited from one generation to the next in “haplotype blocks” • A few variants in each haplotype block used as “proxies” for the entire block in order to-- • ID association of e.g., hypertension in presence/absence of variants across entire genome • Genome-wide Association Study (GWAS) Human Genomic Landscape Circa 2012

  14. 1,000 Genomes Project • NexGen Sequencing (NGS) of 1,092 unidentified research subjects worldwide • Extend findings of GWAS and HapMap projects • More deeply examine all variants (and SNPs) in (~100) regions associated with disease (e.g. diabetes; CAD, etc.) • Create an integrated map of human genetic variation • Together the HapMap, GWAS, and 1,000 Genomes Projects have delivered impressive insights into the workings of the human genome in less than 100 years! Human Genomic Landscape Circa 2012

  15. Gregor Mendel (1882-84)Birth of Modern Genetics Human Genomic Landscape Circa 2012

  16. Step 4. The Need for routine whole genome sequencing at a low cost ($1,000 or less) “I see a time 10 years in the future when every single patient will be surrounded by a virtual cloud of billions of data points, and we’ll have the software to be able to define uniquely the nature of health and the potential of disease for each individual” (Lee Hood, 2003) Nature, April 2003 Human Genomic Landscape Circa 2012

  17. With “NexGen” sequencing technologies the $1,000 Genome is technically a reality… Human Genomic Landscape Circa 2012 ~$1,000,000,000 ~$1,000

  18. The “Real Bottleneck”: Step #5: Getting all this Data in a Useable Form Human Genomic Landscape Circa 2012

  19. The Genomics Marathon:A compelling and exciting run Human Genomic Landscape Circa 2012

  20. The Policy ArenaGenome Sequencing (WGS) and Health Care Delivery • Newborn screening (could be more predictive using WGS • Pharmacotherapy/Personalized Medicine (e.g., CYP2CD and VKORC1SNPs in liver metabolize Warfarin) • Reproductive counseling (WGS would eliminate repeated genetic testing for carriers of conditions) • Disease risk management (improved access to genetic risk information of their choosing. Human Genomic Landscape Circa 2012

  21. Hot Issues in Genomics 2013 • Intellectual Property and Ownership • Insurance reimbursement for genomic services • Regulation of genetic testing • Regulatory and non-regulatory approaches for dealing with DTC genetic testing • Regulation of pharmacogenomics and genomics –based therapeutics • Protection against genetic discrimination and stigmatization • Uses of genomics in non-medical settings (e.g., Forensics) • Electronic Medical Records (EMRs) • Information security, privacy and informed consent • IFs and IRRs (individual Research Results) • Tissue collection, storage and biobanking Human Genomic Landscape Circa 2012

  22. American College of Medical Genetics and Genomics (ACMG) 2013 Report Human Genomic Landscape Circa 2012 • When a patient's full set of genes is sequenced for any medical reason, laboratories should also screen for additional genetic problems, even those [IFs]that are unrelated to the risk justifying genome sequencing in the first place. Patients would then be notified [IRRs] of any additional genetic conditions found. • The report acknowledges ethical issues may arise around patient autonomy and the 'right not to know' but concludes that the doctor's 'duty to prevent harm by warning patients and their families about certain incidental findings' justifies the recommendation.

  23. Points to Consider: Criteria for Communicating Unsolicited Medical Opinion to a Patient • High probability of a serious, impending risk to health; • High risk of non-treatment; • A reasonable person would want to know about such a risk to their health; • Health care provider is reasonably certain of the diagnosis • Treatment is available • Questions: • What if criteria #s1 and 4 are positive but #5 is not available (example?) and risk is less clear(example?) May need to re-think heath care provider training (+ more genetic counselors) Human Genomic Landscape Circa 2012

More Related