ken
Uploaded by
51 SLIDES
772 VUES
510LIKES

Tutorial BioBricks

DESCRIPTION

Tutorial BioBricks. Jan Mertens Elke Van Assche. BioBrick: definitie. Het part zelf begint met eerste letter (A, C, T, G) die volgt op de prefix cloning site van het plasmide en eindigt met de laatste letter voor de suffix cloning site van het plasmide

1 / 51

Download Presentation
Télécharger la présentation

Tutorial BioBricks

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Tutorial BioBricks Jan Mertens Elke Van Assche

  2. BioBrick: definitie • Het part zelf begint met eerste letter (A, C, T, G) die volgt op de prefix cloning site van het plasmide en eindigt met de laatste letter voor de suffix cloning site van het plasmide Part sequentie in de registry: start met de eerste base van het part en eindigt met de laatste base • Vb. Start met ATG en eindigt met TAATAA • Exclusief prefix en suffix • Prefix en suffix liggen op plasmide waarin het part zit • Prefix en suffix hebben knipplaatsen voor EcoRI, XbaI, SpeI, PstI • BioBrick heeft dus geen knipplaatsen voor restrictie-enzymen

  3. Prefix en suffix • BioBrick Prefix • Als het part dat volgt een coderende sequentie is of een ander part dat start met "ATG", dan is de BioBrick prefix : gaattcgcggccgcttctag • Anders is de BioBrick prefix : gaattcgcggccgcttctagag • BioBrick Suffix • De standaard BioBrick suffix is : tactagtagcggccgctgcag • BioBrick Scar • Als BioBricks met deze prefix and suffix sequenties geassembleerd worden is er een "scar“ tussen de parts. • Als het tweede part met "AT“ begint, is de scar tactag • Anders is de scar tactagag

  4. Soorten Biobricks • Basic Parts • Basic Parts zijn atomische eenheden van DNA • De oorsprong is de-novo synthese, genbank, primer extension en PCR, of andere technieken • Zoals alle parts wordt ook een Basic part gehouden in een plasmide • In het plasmide is het omgeven door een restrictie-enzym cloning region, maar de cloning region is geen onderdeel van de sequentie • Composite Parts • Composite Parts zijn functionele eenheden gevormd door een geordende serie Basic of Composite parts • De sequentie zit niet in de registry • Functie en design worden wel gedocumenteerd

  5. Soorten BioBricks (vervolg) • Construction Intermediates • Construction Intermediates hebben geen specifieke functie • Resultaat van de assembly van twee parts • Geen documentatie nodig • Naam van part is dan: 'BBa_Snnnnn‘, automatisch toegewezen door registry software

  6. Biobrick nomenclature

  7. Zoeken van BioBrick per type

  8. Voorbeeld inverters

  9. Tabellen met parts Letter code definities

  10. Plasmiden • Plasmide backbone • Plasmide backbone: elk part wordt gezet op een plasmide • Dit bevat de prefix en suffix en een antibioticumresistentiegen voor selectie • Construction plasmide • Het ccdB toxic gen verzekert dat cellen getransformeerd met niet geknipte of gereligeerde plasmiden niet groeien • Gevormde kolonies zijn waarschijnlijk juist geligeerd

  11. Plasmiden(vervolg) • Plasmide met biobrick parts • Structuur van een plasmide: ori, ab-resistentie en cloningsite

  12. Plasmiden: nomenclatuur ori versienummer pSB#X# plasmid Synthetic Biology Ab-resistentiemerker

  13. Zoeken naar plasmiden

  14. Restrictie-enzymen en knipplaatsen • Restrictie op herkenningssequentie • Enzyme EcoRI • Herkent GAATTC en knipt tussen G en de A op beide strengen. • Sticky ends: AATT • Gebruikt voor verplaatsing van stuk DNA van ene plasmide naar andere • Knippen uit ene plasmide • Andere plasmide openknippen met zelfde enzyme • Zuiveren (enzyme werkt niet optimaal, steractiviteit) • De sticky ends annealen via baseparing (complementair). • Na ligatie is de originele restrictiesite hersteld

  15. Restrictie-enzymen en knipplaatsen (vervolg) • SpeI - XbaI (Mixed Sites) • Deze twee enzymes hebben compatible sticky ends maar incompatible recognition sequences • Dezelfde sticky ends worden verkregen, CTAG • Na ligation vormt de resulterende sequentie geen knipplaats voor XbaI noch voor SpeI = mixed site. • 4 restrictie-enzymen (XbaI, SpeI, EcoRI, PstI) zijn voldoende voor alle DNA manipulaties • Biobrick parts zelf mogen deze herkenningssequenties niet bevatten.

  16. Biobrick assembly • Standard assembly • EcoRI and XbaI knipplaatsen links and SpeI and PstI rechts • Knippen van het fragment (blauw) met EcoRI en SpeI • Knippen van plasmide met groen fragment met EcoRI en XbaI • Zuivering m.b.v. gelelektroforese • Ligatie: E-sticky ends met elkaar, S en X • Transformatie naar E.coli en expressie van het construct

  17. Biobrick assembly (vervolg) • Parallel assembly • Standard assembly duurt te lang als je verschillende parts aan elkaar wilt lassen • Oplossing: parallel • Rolling assembly • Als assembly van 2 parts faalt, zal dit zich in een later stadium oplossen

  18. Ribosoombindingssites (RBS) • Verschillende RBS binden ribosomen met verschillende efficiëntie • Opm. Hoewel dit de globale efficiëntie niet direct bepaalt is dit toch een belangrijke variabele • Standaard assembly: De RBS zit fysisch nabij het startcodon (Bij BioBricks is dit altijd ATG.)

  19. Protocol voor gebruik Biobricks “The Spring 2008 Distribution binder” bevat alle parts uit de registry Het DNA voor alle parts is geïsoleerd en gespot op een filterpapier Extensieve kwaliteitscontrole

  20. Kwaliteitscontrole • Bekijken van platen • In de registry DNA repositories Spring 2008 • Bevat alle platen van 2008 Spring DNA Distribution • Bekijken van kwaliteitscontrole van elk part

  21. Protocol voor gebruik Biobricks • Lokaliseren van een part in de distributie • Nummer intikken in search box • Klikken op Physical DNA • Alle lokaties van een bepaald part • Enkel Physical DNA voor parts die Available zijn

  22. Protocol voor gebruik Biobricks • Paper Punches • Geschatte duur: 1 minuut per spot • Nodige materialen: • TE (10:1, pH 8.0) = tris(hydroxymethyl)aminomethane en EDTA • Desired spot location information • Olfa cutting materiaal (back of binder) • Punch tool • 1.5ml PCR tubes

  23. Protocol voor gebruik Biobricks • Paper Punches • Werkwijze • Warm up 5 μl aliquots of TE buffer to 50ºC in 1.5 ml (PCR) Eppendorf tubes. Warm a water bath to 42 degrees. • Slide the cutting mat under the page in the binder containing the DNA of your part. • Using the punch tool, press down firmly on the spot you want to punch out while rotating the punch tool BUT NOT while pressing the ejector plunger (see the instructions on the punch tool wrapper). The spot is large enough to allow several punches, so punch at the edge of the spot. • Eject the punched paper spot into the tube containing 5 µL of TE buffer by pressing down on the top part of the punch tool. • Spin the tubes containing filter paper spot and TE for ~3 minutes at 15,000 x g. • Be sure to clean the punch tool before punching out another spot, to prevent cross-contamination of parts.

  24. Protocol voor gebruik Biobricks • Punch Tool Cleaning • Geschatte duur: 5 minuten per spot • Nodige materialen: • Blotting paper (back of binder) • 10% bleach • diH2O • 95% ethanol

  25. Protocol voor gebruik Biobricks • Punch Tool Cleaning • Werkwijze • Punch a blank sheet of blotting paper and remove the punched paper. Pull the punch tool apart, so that the black rod is separated from the column. • Dip both the rod and the column briefly into a series of solutions of 10% bleach, distilled water, a second bath of distilled water, and a final bath of 95% ethanol. Opm: We have found that strong detergents tend to remain on the punch tool and can inhibit transformation of the DNA. Ethanol is preferred over isopropanol for the final cleaning bath, as it dries much faster. • Blot with a Kimwipe (= opkuisdoekje) and allow to dry for 5 minutes. Note that the ethanol can wick up inside the column of the punch tool. It is important that the punch tool be completely dry before punching out another DNA spot, as the ethanol will affect the transformation efficiency.

  26. Protocol voor gebruik Biobricks • Transformatie • Geschatte duur: 3 uur (plus 12-14 uur incubation) • Materials needed: • Spots soaked in TE • 2.0ml conical bottom tubes (one per spot) • Ice • Competent cells • 42º water bath / 37º incubator • SOC (check for contamination!) • Petri plates with appropriate antibiotic

  27. Protocol voor gebruik Biobricks • Transformatie • Werkwijze • Soak the spots in 5 µL of the warmed TE for 20 minutes. This allows the maximum concentration of DNA in solution. Start thawing the competent cells on wet crushed ice. • Chill labeled 2 ml conical bottom tubes on wet ice. Add 2 µL of DNA in TE and 50 µL of thawed TOP10 competent cells to the tubes. In our experience, these volumes have the best transformation efficiency. The 2 ml tubes allow better liquid movement during incubation. Extra eluted DNA may be held at least several weeks frozen or at refrigerator temperature. • Hold the DNA and competent cells on ice for 30 minutes. This improves transformation efficiency by a significant amount. • Heat shock the cells by immersion in a pre-heated water bath at 42ºC for 60 seconds. A water bath is important to improve heat transfer to the cells.

  28. Protocol voor gebruik Biobricks • Transformatie • Werkwijze (vervolg) • Incubate the cells on ice for 2 minutes. • Add 200 μl of SOC broth (check that this broth is not turbid, which would indicate previous contamination and bacterial growth). This broth should contain no antibiotics. • Incubate the cells at 37ºC for 2 hours while the tubes are rotating or shaking. We have found that growth for 2 hours helps in transformation efficiency, especially for plasmids with antibiotic resistance other than ampicillin. • Label an LB agar plate containing the appropriate antibiotic(s) with the part number, plasmid, and antibiotic resistance. Plate 250 µl of the incubated cell culture on the plate. • Incubate the plate at 37ºC for 12-14 hours, making sure the agar side of the plate is up. If incubated for too long the antibiotics, especially ampicillin, start to break down and un-transformed cells will begin to grow.

  29. Protocol voor gebruik Biobricks • Transformatie • Opmerkingen • Bij problemen: testen competente cel efficiëntie http://www.openwetware.org/wiki/TOP10_chemically_competent_cells • Plasmide DNA verdunnen tot 10 pg/ul plasmide DNA in TE • Efficientie van 108 cfu/ug is goed

  30. Protocol voor gebruik Biobricks • Making your own Glycerol Stock • Geschatte duur: ~1 hour (after overnight incubation of single colony liquid culture) • Nodige materialen: • Single E. coli colony of transformed part • LB broth with appropriate antibiotic • 15ml tubes • Cryotubes (see below) • 80% glycerol • Label with appropriate information

  31. Protocol voor gebruik Biobricks • Making your own Glycerol Stock • Werkwijze • Pick a single colony from the above plate into 10 ml of LB broth with appropriate antibiotic and grow 12-14 hours to create an overnight liquid culture. • Combine 1 ml of overnight culture and 150 μl of a sterile 80% glycerol solution in a screw-top cryotube. • Vortex briefly. • Incubate at room temperature for 1/2 hour, and place directly into a –80 degree freezer. • Prior to freezing, label the tube with the Biobrick part number, plasmid, and antibiotic resistance. • Glycerol stocks may be used for future access to the part by scraping small amounts of frozen culture from the tube without thawing. The culture can be plated or used directly to infect a liquid culture. Plates containing transformed parts may be held in plastic bags at refrigerator temperature for at least two weeks. • The overnight culture can be used to prepare plasmid DNA with any standard miniprep. We have had good luck with the Qiagen miniprep kits.

  32. Protocol voor gebruik Biobricks • Antibiotica • Ampicillin: 100mg/ml stock solution (add 1ml/L medium) • Kanamycin: 50mg/ml stock solution (add 1ml/L medium) • Chloramphenicol: 35mg/ml stock solution (add 1ml/L medium) • Tetracycline: 5mg/ml stock solution (add 3ml/L medium) • Opmerkingen • Oplossingen in ethanol of 50% ethanol bevriezen niet bij –20 graden, wat handig is voor opslag en gebruik • Antibiotica mogen niet toegevoegd worden aan heet medium, koel het medium tot 55°C vooraleer antibiotica toe te voegen • Tetracycline is lichtgevoelig, platen en medium uit het licht bewaren

  33. Meten van promotoractiviteit • Testpromotor, GFP-reporter, backbone plasmide isoleren • Ligeren en cellen transformeren • Selectie m.b.v. antibioticumresistentie • Activiteit promotor vergelijken met standaardpromotor (BBa_J23101). • Uitgedrukt in Standard Promoter Units (SPUs) zo dat je “part” vergelijkbaar is met andere in de registry. • Je kan eigen metingen laten omzetten naar SPUs door de online registry calculator te gebruiken

  34. Meten van promotoractiviteit Promotor- en ribosoomactiviteit in relatieve eenheden van Standard Promoting Units (SPU) of Standard Ribosome Units (SRU)

  35. Karakterisatie • Metingen van het populatiegemiddelde • Wanneer is het meten van het gedrag van de populatie of het gemiddelde voldoende? • Als we enkel geïnteresseerd zijn in het gedrag van de meerderheid van de cellen. • 1 enkele populatie • Tijdsafhankelijk gedrag kan weergegeven worden (via the plate reader) • DNA • Plasmide copy nummer • RNA • Northern-bloths • RT-PCR • Proteins • Quantitative westernblots • Plate reader

  36. Karakterisatie • Population distributions • Wanneer ben je geïnteresseerd in de populatiedistributies van een groot aantal cellen? • Als er meerder populaties zijn • Wanneer je duizenden cellen wil onderzoeken i.p.v. 10 of 100den • Wanneer je enkel statisch gedrag nodig hebt • DNA • Mogelijkheid tot DNAkleuring met DAPI of iets anders om de DNAinhoud in levende E. coli cellen te karakteriseren? Plasmide copy number? • RNA • Versmelt reporters van single cel metingen met flowcytometrie • Ontwikkel een hight troughput microscopieversie van één van de single cell technieken hieronder • Proteins • Flow Cytometry gebruikmakende van fluorescent proteïne

  37. Karakterisatie • Single cell metingen • Wanneer willen we het gedrag weten in een enkele cel? • Wanneer stochastische effecten belang hebben • Single molecule resolutie • Dynamisch gedrag(want time resolved behavior of each cell lineage) • DNA • Hoe meet je plasmide kopie nummer in een enkele cel? • Misschien FCS gebruiken met een DNA-bindend proteïne specifiek voor je plasmide geconjugeerd met GFP. Vereist veel werk omtrent de methode

  38. Karakterisatie • Single cell measurements • RNA • Endy: Journal Club: Le et al 2005 • Ido Golding approach • Beide benaderingen zijn gebaseerd op hetzelfde soort RNA-MS2 proteïne binding. Le et al. Gebruikt dan FCS om niveaus van gebonden proteïne aan RNA te meten terwijl Golding et al. Individueel RNA tracht te traceren via fluorescentie microscopie. Beide methodes zijn zeer gevoelig maar beiden verstoren waarschijnlijk het systeem dat gemeten wordt. • Protein • Fluorescence correlation spectroscopy

  39. Voorbeeld Part:BBa_F2620 • Signaling part (want F) • Beschrijving: • Een transcriptiefactor [LuxR] (BBa_C0062) die actief is in aanwezigheid van cel-cel signaalmolecule 3OC6HSL gecontrolleerd door tetR reguleerbare operator (BBa_R0040). Device input is 3OC6HSL. Device output is PoPS van een LuxR-gereguleerde operator.

  40. Voorbeeld: legende • BBa_C0062: luxR repressor/activator • Als gecomplexeerd met HSL, bindt LuxR aan de Luxpromotor en activeert de transcriptie van Pr BBa_R0062, • 3OC6HSL • Afkomstig van V. fischeri, bindt met het LuxRgenproduct van het Lux operon. Het resulterende complex kan binden met de lux box en regelt transcriptie van de luxpromotors. • Part:BBa_R0040 • Sequenties voor pTet inverting regulator. De promotor staat constitiutief aan en wordt gerepressed door Tet R. TetR repressie wordt geïnhibeerd door toevoeging van tetracycline en of zijn analoog aTc. • Polymerase Per Second: Polymerase Per Second (PoPS) ; aantal keren dat een RNA polymerase molecule een specifieke locatie (bvb. Promotor, RBS) op het DNA passeert per tijdseenheid. PoPS wordt indirect gemeten door een test gen te introduceren met dezelfde regulatorische regio, maar met een CFP proteïne coderend gen. De fluorescentie wordt hiervan gemeten.

  41. Voorbeeld: transferfunctie De transferfunctie beschrijft het evenwicht tussen input (exogene HSL concentratie) en output (PoPS) signaal. Een fluorescent reporter device werd hiervoor gebruikt om de output te meten bij verschillende exogene concentraties HSL.

  42. Voorbeeld transferfunctie (2)

  43. Voorbeeld: specificiteit Transferfuncties voor 8 verschillende AHL molecules als input Specificiteit: onderscheid moet gemaakt kunnen worden tussen de echte input en andere gelijkende inputs (veel AHL molecules met een gelijkende structuur aan 3OC6HSL ). Karakterisatie van de respons van BBa_F2620 op andere AHL molecules is nodig.

  44. Voorbeeld: responstijd Responstijd meet de tijd voor de respons van de output op de input. In dit voorbeeld: respons van BBa_F2620 gemeten d.m.v. stijging van het inputsignaal (AHL concentratie van 0 tot 100 nM )stap voor stap

  45. Voorbeeld: stabiliteit • “Device” stabiliteit beschrijft hoe de transferfunctie van het device verandert na verschillende rondes van celdeling en in cultuur brengen. • reporter device, BBa_E0240 to indirectly measure the output from BBa_F2620 • Performantie van het device werd gemeten onder hoge en lage inputcondities over 92 generaties. Performantie constant Performantie daalt snel na 74 generaties

  46. Voorbeeld stabiliteit (2) • Oorzaak van dalende performantie na 74 generaties: • Deletiemutant mutant die in het begin al in een fractie van de cellen aanwezig was (die na 74 generaties de cultuur overheerst bij hoge input)

  47. Voorbeeld Part:BBa_F2620 • Compatibiliteit • Bacteriële stam: • transcriptie hangt af van de gebruikte stam (juiste sigmafactoren, RNApolymerases) • Plasmiden • Device werkt niet op alle plasmiden • Devices • Mogelijke interferentie met andere devices • Cel signalisatie • Crosstalk tussen verschillende quorum sensing systemen

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer