90 likes | 235 Vues
Review – Chapter 4. Chapter 4. Name three differences between plant and animal cells. A – What is the purpose of the ribosome? A – What is the power house of the cell? A –. Cell Parts Continued. What is the purpose of the endoplasmic reticulum? A – How do proteins leave the cell?
E N D
Chapter 4 • Name three differences between plant and animal cells. A – • What is the purpose of the ribosome? A – • What is the power house of the cell? A –
Cell Parts Continued • What is the purpose of the endoplasmic reticulum? A – • How do proteins leave the cell? A – • What would happen if the nucleus of a cell was taken out? A –
DNA • Where is DNA found? A – • What does DNA stand for? A – • What shape does DNA take? A – • What three parts make up DNA? A –
DNA • What does A, G, C and T stand for? A – • What does adenine pair with? A – • Most of the time, DNA exists in the nucleus in the form of what? A – • What does DNA code for? A –
Chromosomes • How many pairs of chromosomes are found in human cells? A – • If your 23rd pair of chromosomes is XY, you would be a … A – • Small segments of DNA are called what? A -
Genes/Proteins • What is the importance of genes? A – • Which of the following are not specialized proteins: hormones, nucleolus, enzyme? A – • Why are stomach cells different from skin cells? A –
Protein Production • What does RNA stand for? A – • How is the message for a protein to be made carried from the nucleus to the ribosomes? A – • What is the function of the Golgi body? A –
Mutations • What type of mutation is occurring in the following DNA sequence (and where): CATGCCTGACGTCTGATGCCA Mutation 1: CATGCCTGACCTCTGATGCCA A – Mutation 2: CATGCCTGACGTCTGATGCCAA A – Mutation 3: CATCCTGACGTCTGATGCCA A –