kineta
Uploaded by
33 SLIDES
792 VUES
410LIKES

Phylogenetic methods

DESCRIPTION

Phylogenetic methods. Thanks to:. Applications of phylogenetic trees. Evolution studies Systematic biology Medical research and epidemiology Ecology Others like grouping languages, medieval manuscripts …. Phylogenetics: basics.

1 / 33

Télécharger la présentation

Phylogenetic methods

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Phylogenetic methods Thanks to:

  2. Applications of phylogenetic trees • Evolution studies • Systematic biology • Medical research and epidemiology • Ecology • Others like grouping languages, medieval manuscripts …

  3. Phylogenetics: basics • With only 2 sequences, we can simply align them and look at their similarities or differences (how many, where they are in the molecule, and so on). • More than 2 sequences, they are related to each other as a result of a branching evolutionary history, and they are located at the tips of a tree of species (except if HGT or sampling within species) • Phylogenies (evolutionary trees) can be inferred from molecular sequences. They can be used to address a wide variety of questions about the course of evolution. They are needed not only to know the relationships of organisms, but to enable us to correctly interpret rates of evolution and the evolution of different parts of different molecules. • In examining a phylogeny diagram, it is important to look at the branching pattern and not be misled by the order of species names on the page, or the left-right order of branching of lineages.

  4. Terminology Rooted tree Unrooted tree

  5. Trees: rooted or unrooted? • Rooted trees indicate the direction of evolution, and the ancestor (more useful) • Unrooted trees only show patterns of relationship (more common) • The root can be placed on a tree by two methods: • The outgroup method. This amounts to knowing in advance where it is. • A molecular clock. If we assume that rates of change are about the same up all lineages, then the root will be a point which is equidistant from all the tips. It is not necessarily easy to see where this is. • The molecular clock is the assumption that change occurs at a constant expected rate, so that all tips of the tree are equidistant from the root. This is better the more closely related the species are, but breaks down as their biology becomes more different. It is often a useful approximation.

  6. Advantages of molecular phylogenetic analysis • Analogous features (share common function, but NOT common ancestry) can be misleading • DNA sequences more simple to model, we only have the four states A, C, G, T • DNA samples for sequence analysis easy to prepare

  7. Procedure: Steps of a molecular phylogenetic analysis • Decide what sequences to examine • Determine the evolutionary distances between the sequences and build distance matrix • Phylogenetic tree construction

  8. 1. Decide what to examine • Choose homologous sequences in different species • Homologous sequences must, by definition, be derived from a common ancestral sequence • Homology is not similarity

  9. 2. Determine the evolutionary distances and build distance matrix • For molecular data, evolutionary distances can be the observed number of nucleotide differences between the pairs of species. • Distance matrix: simply a table showing the evolutionary distances between all pairs of sequences in the dataset

  10. 2. Determine the evolutionary distances and build distance matrix - A simple example • AGGCCATGAATTAAGAATAA • AGCCCATGGATAAAGAGTAA • AGGACATGAATTAAGAATAA • AAGCCAAGAATTACGAATAA Distance Matrix In this example the evolutionary distance is expressed as the number of nucleotide differences for each sequence pair. For example, sequences 1 and 2 are 20 nucleotides in length and have four differences, corresponding to an evolutionary difference of 4/20 = 0.2.

  11. 3. Phylogenetic Tree Construction example (UPGMA algorithm) 1. Pick smallest entry Dij 2. Join the two intersecting species and assign branch lengths Dij/2to each of the nodes UPMGA (Michener & Sokal 1957) Bear Raccoon 0.130.13

  12. 3. Phylogenetic Tree Construction example (UPGMA algorithm) Bear Raccoon 0.13 0.13 3.Compute new distances to the other species using arithmetic means

  13. 3. Phylogenetic Tree Construction example (UPGMA algorithm) Bear Raccoon Seal 0.13 0.18250.1825 • 1. Pick smallest entry Dij • 2. Join the two intersecting species and assign branch lengths Dij/2 to each of the nodes

  14. 3. Phylogenetic Tree Construction example (UPGMA algorithm) Bear Raccoon Seal 0.13 0.18250.1825 • Compute new distances to the other species using arithmetic means

  15. 3. Phylogenetic Tree Construction example (UPGMA algorithm) Bear Raccoon Seal Weasel 0.13 0.1825 0.2 0.2 • Pick smallest entry Dij. • Join the two intersecting species and assign branch lengths Dij/2 to each of the nodes. • Done!

  16. Correct tree UPGMA 3 2 4 1 3 4 2 1 Weakness of UPGMA • UPGMA assumes a constant molecular clock (i.e. accumulate mutations at the same rate) • All leaves in the same level • Only constructs rooted trees

  17. Neighbor Joining (Saitou and Nei, 1987) • Most widely used distance-based method • UPGMA showed that it is not enough to just pick closest neighbors • Neighbor Joining: • Principle: Join nodes that are close to each other and far from everything else • Produces an unrooted tree • Multiple substitutions at the same site (homoplasy) obscure true distance and make sequences artificially close to one another.

  18. Methods • When there is conflict among characters as to what phylogenies they support, we need some way of choosing among them a best estimate. Maximum parsimony chooses that phylogeny on which the characters can evolve with the fewest evolutionary events.

  19. Long branch attraction • A phenomenon in phylogeny (esp. parsimony) when rapidly evolving lineages are inferred to be closely related, regardless of their true evolutionary relationships. • Esp. a problem with DNA sequence (rather than protein sequence or other more complex trait combinations), b/c there are only 4 nucleotides • When DNA substitution rates are high, the probability that two lineages will convergently evolve the same nucleotide at the same site increases. • Parsimony wrongly interprets this similarity as having evolved only once in a common ancestor of the two lineages • Problem can be minimized by using methods that incorporate differential rates of substitution among lineages (e.g., maximum likelihood) or by breaking up long branches by adding taxa that are related to those with the long branches.

  20. Other methods • Maximum likelihood. The probability of the data is computed, given the tree and a probabilistic model of evolution. We choose that tree that gives the highest probability to the observed data, among all trees.

  21. Maximum Likelihood • Search through all trees to find the one with highest probability • Assumed to be “NP-complete“ • For a given tree, we can calculate its likelihood score • Markov model • Dynamic programming • Very time-consuming

  22. Which method to use? • Distance based • fast • Maximum Parsimony • Strong sequence similarity • Maximum Likelihood • Very slow • Use only for small number of sequences • Most packages (e.g. Phylip, MEGA) use software for all three methods.

  23. Methods of evaluating trees • Bootstrap: resample initial data set with one datum removed and replaced with another member • Jackknife: resample initial distribution with one datum missing and not replaced • MCMC: complex, but generates random numbers to produce a desired probability distribution with which to compare model

  24. Monte Carlo method

  25. Bayesian phylogenetics • Newer method • Produces both a tree estimate and measures of uncertainty for the groups on the tree • Similar to ML. • Optimal hypothesis is the one that maximizes the posterior probability, = the likelihood multiplied by the PRIOR PROBABILITY of that hypothesis. • Prior probabilities of different hypotheses convey the scientist’s beliefs before having seen the data.

  26. Rates and causes of molecular evolution • Different parts of the genome are useful for different problems. Fast evolving sequences are useful for recent events, but become saturated and unrecognizable when comparing more distant relatives. Slow evolving sequences are useful around the base of the tree, but don’t have any variability at all among close relatives.

  27. Different molecular regions, different rates • DNA distant from genes evolves very quickly (at about one substitution per 108 years), • Flanking regions upstream and downstream from a gene evolve less quickly than that, • Introns evolve less quickly than those, though not much less, • Third positions of codons evolve less quickly than introns, • First and second positions of codons evolve less quickly than that,

  28. Different molecular regions, different rates Within a protein: – active sites evolve very slowly, – sites that bind heme, or interact with other proteins evolve a bit faster but also very slowly, – interior sites evolve less quickly than exterior sites, – substitutions that involve less radical changes of the amino acid (i.e. that change to a rather similar amino acid) happen more readily. Of base changes, transitions (A -> G or C -> T) happen several times more readily than transversions (all other changes). Between protein-coding loci, some (fibrinopeptide, for example) evolve rapidly, some less so (hemoglobins, cytochromes), and some (histones, for example)change very slowly.

More Related