elu
Uploaded by
22 SLIDES
499 VUES
220LIKES

Phylogenetic Trees

DESCRIPTION

Tutorial 5. Phylogenetic Trees. A. C. D. B. Multiple Sequence Alignment – When?. More than two sequences DNA Protein Find evolutionary relation Homology  Phylogenetic tree Detect motif. GTCGTAGTCGGCTCGAC GTCTAGCGAGCGTGAT GCGAAGAGGCGAGC GCCGTCGCGTCGTAAC.

1 / 22

Download Presentation
Télécharger la présentation

Phylogenetic Trees

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Tutorial 5 Phylogenetic Trees

  2. A C D B Multiple Sequence Alignment – When? • More than two sequences • DNA • Protein • Find evolutionary relation • Homology  Phylogenetic tree • Detect motif GTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC

  3. A C D B Multiple Sequence Alignment – How? • Dynamic Programming • Optimal alignment • Exponential in #Sequences • Progressive Alignment (also known as hierarchical, incremental or tree method) • Heuristic • Efficient GTCGTAGTCGGCTCGACGTCTAGCGAGCGTGATGCGAAGAGGCGAGCGCCGTCGCGTCGTAAC GTCGTAGTCG-GC-TCGACGTC-TAG-CGAGCGT-GATGC-GAAG-AG-GCG-AG-CGCCGTCG-CG-TCGTA-AC

  4. Progressive Alignment 1 1 3 TGTTAAC TGT-AAC TGT--AC ATGT--C ATGTGGC 2 2 3

  5. Progressive Alignment 1 • Note: • Not all matrices can be embedded in a tree without error. 3 TGTTAAC TGT-AAC TGT--AC ATGT--C ATGTGGC 2

  6. Neighbor Joining Algorithm Constructs an unrooted guide tree from a distance matrix 6

  7. Neighbor Joining Algorithm • Calculate all pairwise distances. • Find 2 nodes i and j, such that the relative distance between i and j is minimal. • Remove the rows and columns of i and j • Add a new row and column k (the parent of i and j), and compute the distance from k to any other remaining node. • Continue until two nodes remain – connect with edge.

  8. Step 1. Calculate all pairwise distances • A, B, …, E are tree nodes. Each character represents a sequence. • How can we measure distance between sequences???

  9. Step 1. Calculate all pairwise distances distance between sequences • Euclidean Distance: Given a multiple sequence alignment, calculate the square root of the sum of the score at every position between two sequences • The score increases as the dissimilarity between residues increases.

  10. Step 2. Two nodes with minimal relative distance problem • To find neighboring leaves we simply select a pair of closest leaves. • WRONG !

  11. Step 2. Two nodes with minimal relative distance problem • Closest leaves aren’t necessarily neighbors • i and j are neighbors, but (dij= 13) > (djk = 12)

  12. Step 2. Two nodes with minimal relative distance solution • Find a pair of leaves that are close to each other, but far from other leaves. • This is called “relative distance”.

  13. Step 2. Two nodes with minimal relative distance Relative distance between i and j Distance between i and j from the distance table Distance of i from all other sequences Number of leaves (=sequences) left in the tree

  14. Step 2. Two nodes with minimal relative distance Original distances matrix:

  15. Step 2. Two nodes with minimal relative distance The relative distance table: A,B is the pair with the minimal Mi,j distance. The Mij Table is used only to choose the closest pairs (lowest value) and not for calculating the distances

  16. Steps 3+4. Remove i, j and add k to the matrix the distance from k to any other leaf m can be computed as: Dkm = (Dim + Djm – Dij)/2 Compress i and j into k, iterate algorithm for rest of tree

  17. Steps 3+4. Remove i, j and add k to the matrix Now we’ll calculate the distance from X to all other nodes.

  18. Steps 5. Continue till 2 nodes remain The final tree: 5 Z 9 C Y 20 X 6 12 E B 4 10 D A What’s missing?

  19. Distance of a neighboring pair to their parent node • After defining A,B as neighbors, and defining k as their parent node, • How do we compute the distances: • d(A,k), d(B,k)?

  20. Phylogeny.fr

  21. Phylogeny.fr

  22. Phylogeny.fr

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer