mwarner
Uploaded by
25 SLIDES
303 VUES
250LIKES

Phylogenetic Inference

DESCRIPTION

Learn how to create phylogenetic trees to represent evolutionary history, understand shared and derived characteristics, and differentiate between homology and homoplasy.

1 / 25

Télécharger la présentation

Phylogenetic Inference

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Phylogenetics Given a list of taxa, how could you come up with a phylogenetic tree that you could have confidence represented evolutionary history? PhylogeneticInference

  2. Marsupial Monotreme Reptile Placental Bird Phylogenetic Inference • Evolution produces a branching pattern of relationships…BUT • We only see living organisms; We cannot look into the past and see how populations diverge. • Many different trees are possible, each suggesting a different history and different relationships • How can we objectively decide which tree is right? Marsupial Placental Monotreme Reptile Bird Present ? Past Marsupial Marsupial Marsupial Placental Placental Placental Monotreme Monotreme Monotreme Reptile Reptile Reptile Bird Bird Bird Marsupial Placental Reptile Monotreme Bird

  3. Introduction to the Problem of Phylogenetic Inference • Characteristics that organisms have in common are used in at least two ways when building phylogenetic trees: • The basis for creating a nodes which group taxa together • Evaluating and comparing trees to determine which is preferred. • ‘Naive’ method: Draw nodes joining all taxa that share a characteristic • Because different trees are possible depending on which characteristics are given priority, this reveals that sharing characteristics is not sufficient to establish relationships. • Some criterion must be used to determine which characteristics can be reliably used to establish relationships. Amphibians Amphibians Lizards Platypus Crocs Birds Eutherians Marsupials Platypus Lizards Crocs Birds Eutherians Marsupials

  4. To infer a phylogenetic group between two or more taxa, we must have a way to prioritize which characteristics are used. • To be useful in forming clades, characters MUST be Shared Derived Charactersfor all taxa being grouped: • Homologous: Feature that are derived from the same structure in the a common ancestor • Shared State: The features must be in the same state, as inherited from a common ancestor • Derived: Must not be the ancestral state (the same state as is found at the root of the tree) • If any of these requirements are not met, the feature would suggest incorrect relationships. Character States

  5. Descent with Modification:Lungs and Air Bladders Pouch adapted as a swim bladder Pouch adapted as lungs Ancestor of ray-finned fish Ancestor of lobe-finned fish and tetrapods Individuals with mutations causing expansion of the pouch are favored by selection. Pouch randomly develops off gut tube…happens to increases buoyancy Ancestor with non-branched gut tube

  6. Divergence and Homology • Homologous Structures: • Definition: Structures which evolved from the same feature in a common ancestor • Therefore: May be similar or very dissimilar in superficial appearance and function • Clues to Homology: Deep structure is similar • Clues to Homology : Similar embryonic development and underlying structure can be a clue that two structure are homologous Each forms developmentally as a expanding pouch branching off of the gut tube Pouch adapted as a swim bladder Pouch adapted as lungs Note: Even though they are homologous, Lungs and Air bladders are not in the same state. Small Duct off of Gut Tube in Common Ancestor

  7. Divergence and Homology • Homologous Structures: • Definition: Structures which evolved from the same feature in a common ancestor • Therefore: May be similar or very dissimilar in superficial appearance and function • Clues to Homology: Deep structure is similar • Clues to Homology : Similar embryonic development and underlying structure can be a clue that two structure are homologous Butterfly Sea Star Turtle Human Whale Squid Birds Deer Bat Metacarpal Phalanges Humerus Radius Carpal Ulna Human Tetrapod Limbs (Tiktaalik) Turtle Bat Whale Bird

  8. Divergence and Homology Butterfly Sea Star Turtle Human Whale Squid Birds Deer Bat Metacarpal Phalanges Humerus Radius Carpal Ulna Human Tetrapod Limbs (Tiktaalik) • Shared State: • All these limbs are Homologous • Each unique form is a Shared Derived State and could be used to form phylogenetic groups (with some caution) • A Birdclade could be inferred based on the structure of their wings. • A separate Batclade could be inferred based on the structure of their wings. • Etc. Turtle Bat If all I knew about an organism is that it had this bone structure, which of the groups above should I pair it with to form a clade? Whale Bird

  9. Convergence and Homoplasy (Analogy) Mollusca Porifera Cnidaria Platyhelminthes Annelida Nematoda Arthropoda Echinodermata Chordata Rotifera Choanoflagellates • Homoplasious Structures: • Structures which are similar in form and function that arose independently. • Arise via Convergent Evolution • Do not arise from the same structure in their common ancestor • Occurs when similar selective pressures act along two independent branches • Will have different embryonic development and underlying structure • Reveals physical principles relevant to form and function • CANNOT be used to infer clades. MRCA – no Chamber Eyes Vertebrate Eye Squid Eye 9 = Light Sensitive Cell = Blind Spot

  10. Examples of Convergent Evolution • Placental mammals and Marsupial Mammals evolved independently from a rodent-like common ancestor • Have independently evolved species with similar forms and niches

  11. Homology vs. Homoplasy VERSUS • Homologous Structures: • Superficially Different features that are derived from the same character in a common ancestor. • BUT: the closer you look the more similar they become (underlying structure and embryonic development) • Homoplasious Structures: • SuperficiallySimilar in form and function features that evolved independently due to common selective pressures • BUT: the closer you look the more different they become (underlying structure and embryonic development). Butterfly Sea Star Turtle Human Whale Squid Birds Deer Bat Metacarpal Phalanges Humerus Radius Carpal Ulna Eye Eye Tetrapod Limbs Human Turtle Bat Vertebrate Eye Squid Eye Whale Bird

  12. Why Only Shared Derived Charcters? • Shared derived character states are the only reliable criterion on which phylogenetic relationships can be built. • What happens when relationships are built based on pleisiomorphic traits? Tree Inferred without distinguishing ancestral vs. inferred traits True Tree A B C D E F G A B C D E F G Ancestral State Derived State

  13. Which is Ancestral and Which is Derived? Unrooted Tree Rooted Tree Leopard Lions Wolf House Cat Wolf Tigers Leopard Cheetah House Cat Cheetah Lions • The distinction between Ancestral and Derived states is only possible on rooted trees. • The most common method of rooting a tree is through inclusion of an outgroup. • If a character exhibits variable states in the ingroup, the state in the outgroup is taken to be the ancestral state. • If the outgroup doesn’t exhibit a state found in the ingroup, it may not be possible to tell which state is ancestral. Tigers

  14. To infer a phylogenetic group between two or more taxa, we must have a way to prioritize which characteristics are used. • To be useful in forming clades, characters MUST be Shared Derived Charactersfor all taxa being grouped: • Homologous: Feature that are derived from the same structure in the a common ancestor • Shared State: The features must be in the same state, as inherited from a common ancestor • Derived: Must not be the ancestral state (the same state as is found at the root of the tree) • If any of these requirements are not met, the feature would suggest incorrect relationships. As it turns out… To know that a character has all these qualifications, we have to know what the true tree is first… So…

  15. Marsupial Monotreme Reptile Placental Bird Phylogenetic Inference • So…methods are used to avoid this determination by evaluating al possible trees to see determine which one best explains the data. • Gather data on the species in question • Draw all possible treesfor all possible relationships (or as many as possible) • Map how each character may have changed along each tree to produce the data • Select the “best” tree as the most probable. Marsupial Placental Monotreme Reptile Bird Present ? Past Marsupial Marsupial Marsupial Placental Placental Placental Monotreme Monotreme Monotreme Reptile Reptile Reptile Bird Bird Bird Marsupial Placental Reptile Monotreme Bird

  16. Phylogenetic Inference Step 1: Data Epi. Growth Birth Milk • Types of Data: • Morphological • Behavioral • Fossil • Molecular • DNA Sequences • Protein Sequences • Chromosome Structure • RNA Folding Patterns • Gene Duplications TTATATACCATTAGGCCACGGGGAAAA Bird Scales Egg No Crocodile Scales Egg No Platypus Hair Egg Milk Human Hair Live Milk Kangaroo Hair Live Milk TTATATACCATTA___CACATA_AAAA TTCTATACCATTA___CACATA_AAAA Kangaroo TTCTATACCATTA___CACATA_AAAA Human Platypus TTATATACCATTAGGCCACGTAGAAAA Bird • Advantages of Molecular data • Capable of producing substantially larger data sets (1000s of characters easily) • Helps remove bias due to human perception • Allows comparison of organisms with no morphological similarities (e.g. humans, apple trees, fireflies, bacteria, yeast, and mushrooms) Crocodile

  17. Phylogenetic Inference Step 2: Possible Trees • To avoid bias, all possible trees should receive equal consideration as potentially representing evolutionary history. • How many trees are possible for a given number of species? • f.y.i. The number of unique rooted trees for n taxa= [(2n-3)!] / [2n-2*(n-2)!] • Conclusion: Under most circumstances not all possible trees can be considered – methods are used to select a subset of trees to evaluate. For Comparison Estimated Number of Stars in the Observable Universe:  6 x 1022 Estimated Number of Atoms in the Observable Universe: 9.4×1079 Possible Trees for 5 + a root.

  18. Phylogenetic Inference Step 3: Map Characters • Character evolution can be mapped to a tree by marking changes along the branches of the tree. • Multiple histories are possible for each tree. • Principle of Parsimony: • Generally: the simplest solution which explains all the data is preferred. • In Phylogenetics: for any tree and character, the preferred mapping is the one with the fewest number of changes. • All characters are mapped parsimoniously onto every tree being considered (only 1 is shown). Epi. Growth Birth Milk Bird Scales Egg No Crocodile Scales Egg No Platypus Hair Egg Milk Human Hair Live Milk Kangaroo Hair Live Milk Molecular Data (e.g. DNA alignments) can be mapped in the same way DNA Alignment 1 2 3 4 etc. 1AG 1AG Bird C T C … L L 2TC 2TC L 2TC Crocodile C T C … M M M 3CA 3CA 3CA Most Parsimonious Mapping H H H H S S S 1AG 1AC 1AC 1AC Platypus G T A … Human G C A … ATC None Epi. Growth Egg No Milk None Epi. Growth Egg No Milk ATC Kangaroo G C A …

  19. Phylogenetic Inference Step 4: Evaluate Trees • After mapping all characters parsimoniously to all trees, how is one tree chosen? • Maximum Parsimony: Criterion which says the best tree is the one which requires the fewest evolutionary changes for all characters • Tree Length: The total number of changes required for all characters on the tree • The tree with the shortest Tree Length is regarded as being the closest to the “true” tree showing actual evolutionary history. Epi. Growth Birth Milk Bird Scales Egg No Crocodile Scales Egg No Platypus Hair Egg Milk Human Hair Live Milk Kangaroo Hair Live Milk Optimal Tree Under Maximum Parsimony Length of 8 Length of 4 Length of 5 None Epi. Growth Egg No Milk None Epi. Growth Egg No Milk No Epi. Growth Egg No Milk

  20. Inferring evolutionary relationships (see previous slides) • Framework for understanding and testing patterns of evolution • Classification and Identification of species • Forensics • Others • Determining when in history events occurred • Making inferences about the characteristics of extinct species Phylogenetics Applications of Phylogenetics

  21. Evolution of Characters To understand the relationship between characters in different species, such as wings in these organisms, we need to understand how characters evolve in the context of a phylogeny.

  22. Molecular clocks • The “Molecular clock” can be used to estimate times of divergence • At least 2 Requirements: 1) Molecular Phylogeny and 2) Calibration Points 1) Molecular analysis(α-globin) 2) Calibration Point (e.g. Fossils) Fossil ancestor of Dolphin and Horse found to be 87 million years old 49 nuc. changes 87 million years 87my Analysis using Molecular Clock 59 nuc. changes = 105my ? t # different nucleotides t = 105 million years* 49 *Note: This assumes that mutation rate is constant AND is the same between species. 59

  23. Applications of Phylogenetics • Making inferences about the characteristics of extinct species • Birds vocalize to their mates, lay eggs in a nest, and provide parental care • Crocodiles vocalize to their mates, lay eggs in a nest, and provide parental care • Dinosaurs… • Laid eggs in a nest and provided parental care • Because they share a common ancestor with Birds and Crocodiles, these behaviors are homologous. • Phylogeny then suggests that they also probably vocalized to their mates

  24. Forensic Application of Phylogenetics • Tracking disease outbreaks • Testing food markets for illegally sold meat • Forensics

  25. Ebola Outbreak

More Related