1 / 33

Understanding Gene Expression: From DNA to Proteins

Explore the intricate process of how genes are decoded to create proteins, from transcription to translation. Learn about the flow of genetic information, the Central Dogma, and the role of RNA in gene expression. Discover the importance of splicing, alternative splicing, and post-transcriptional modifications in creating functional proteins. Unveil the genetic code, codon system, and translation of mRNA into amino acids. Delve into the structure and function of tRNA, ribosomes, and the crucial role of aminoacyl tRNA synthetases in protein synthesis.

kristy
Télécharger la présentation

Understanding Gene Expression: From DNA to Proteins

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From Gene to Protein How Genes Work

  2. What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

  3. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait replication

  4. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

  5. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  6. Transcription fromDNA languagetoRNA language

  7. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA transcription DNA RNA

  8. Transcription • Making mRNA • transcribed DNA strand = template strand • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  9. Initiation • Promoter region • binding site before beginning of gene • TATA box binding site • binding site for RNA polymerase

  10. RNA polymerase Elongation A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  11. Termination • Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known)

  12. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA

  13. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = pre-mRNA • mRNA splicing • edit out introns • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  14. Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  15. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes

  16. Alternative splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons

  17. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • add 5 GTP cap • add poly-A tail • longer tail, mRNA lasts longer: produces more protein

  18. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  19. Translation fromnucleic acid languagetoamino acid language

  20. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  21. mRNA codes for proteins in triplets

  22. 1960 | 1968 Cracking the code Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine

  23. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  24. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  25. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  26. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  27. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  28. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  29. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  30. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  31. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • Signal peptide • address label start of a secretory pathway

  32. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

  33. enhancer exons 1000+b 20-30b RNA polymerase DNA introns promoter pre-mRNA 5' 3' 5' 3' mature mRNA The Transcriptional unit (gene?) transcriptional unit (gene) 3' 5' TATA DNA GTP AAAAAAAA

More Related