pcr amplification of phage genes - PowerPoint PPT Presentation

pcr amplification of phage genes n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
pcr amplification of phage genes PowerPoint Presentation
Download Presentation
pcr amplification of phage genes

play fullscreen
1 / 10
pcr amplification of phage genes
62 Views
Download Presentation
lainey
Download Presentation

pcr amplification of phage genes

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. pcr amplification of phage genes Tucson High School Biotechnology Course Spring 2010

  2. pcr (polymerase chain reaction) dsDNA (double stranded) ssDNA (single stranded) dsDNA (double stranded) What do we need to do this?

  3. What do we need to do this? dsDNA (double stranded) ssDNA (single stranded) polymerase primer dNTPs (dATP, dGTP, dCTP, dTTP) MgCl2

  4. Still won’t work… dsDNA (double stranded) 94ºC ssDNA (single stranded) 52ºC primer 72ºC polymerase taq polymerase Thermusaquaticus primer dsDNA (double stranded)

  5. What primers are we using? psbA-forward GTNGAYATHGAYGGNATHMGNGARCC psbA-reverse GGRAARTTRTGNGCRTTNCKYTCRTGCAT DNApol-forward GAYACIYTIRYIYTITCIMG DNApol-reverse GGIAYYTGIGCIARRTTIGG g23-forward ATTTGIGGIGTTCAGCCIATGA g23-reverse CGCGGTTGATTTCCAGCATGATTTC DEGENERATE PRIMERS N - A, C, G, T M - A, C Y – C, T R - A, G H - A, C, T

  6. Why use degenerate bases?

  7. Why use degenerate bases? virus Bob A ACTGCAGTA A virus Emma A ACTGCAGTA A virus Estelle A ACTGCAGTA A virus Rick A ACTGCAGTA A PRIMER T TGACGTCAT T

  8. Why use degenerate bases? virus Bob A ACTGCAGTA A virus Emma A CCTACCGTA A virus Estelle A TCCACCGTCA virus Rick A GCCGCTGTCA PRIMER T N G Y R G H CA M T

  9. Today… 1 Master Mix in 3 tubes dNTPs Taq polymerase MgCl2 water + psbA primer + DNApol primer + g23 primer + virus DNA + virus DNA + virus DNA

  10. What do we have to be aware of? CONTAMINATION psbA primer psbA MM DNApol primer DNApol MM g23 primer g23 MM