Genes & Cell Biology
Genes & Cell Biology. Genes. DNA (Deoxy-ribo-Nucleic Acid) First “seen” by Swiss biochemist Johann Miescher by studying puss-filled bandages! Basic function: Code for proteins Only 2% of the total DNA actually codes for protein Remaining 98% is “non-coding”
Genes & Cell Biology
E N D
Presentation Transcript
Genes DNA (Deoxy-ribo-Nucleic Acid) First “seen” by Swiss biochemist Johann Miescher by studying puss-filled bandages! Basic function: Code for proteins Only 2% of the total DNA actually codes for protein Remaining 98% is “non-coding” Important for structure, regulating gene activity…only a very small amount is “useless” Recall that proteins are the most important molecule in a cell because they…..
DNA A double stranded molecule (chain) 2 nm wide Made of monomers of “nucleotides” 1 nucleotide = sugar group (ribose), phosphate group, and a single or double “nitrogenous base” ring 3 bases have a single nitrogen ring Cytosine, Thymine and Uracil Single nitrogen ring = pyrimidine 2 bases have a double nitrogen ring Adenine, Guanine Double nitrogen ring = purine
DNA This region us what makes each nucleotide different This region is always the same
DNA A double stranded molecule (chain) The nucleotides are usually called by their first letter: A = adenine G = guanine T = thymine C = cytosine DNA is only made up of 4 nucleotides….A G T & C U = uracil (this is only seen in RNA…we’ll talk about that soon)
DNA A double stranded molecule (chain) The double strand looks like a ladder
DNA A double stranded molecule (chain) “law of complementary base pairing” Recall that DNA is 2 nm wide From 1 side of the ladder to the other is 2 nm Nucleotides will ONLY pair in a specific manner A will only pair (hydrogen bond) with T G will only pair (hydrogen bond) with C Combination of pyrimidine and purine = 2 nm width You CANNOT get G-T, A-A, C-A, C-T, T-T, or any other combination… It can ONLY be A-T and G-C
DNA A double stranded molecule (chain) “law of complementary base pairing” Based on this law, if you know the nucleotide sequence from 1 strand, you can predict the sequence on the other “complementary” strand ATTAGCCA is the sequence you know TAATCGGT is the sequence you predict, based on the fact that only T-A and G-C can pair to form the “rung” of the DNA ladder
T If you only knew the sequence of 1 strand, the “law of complementary base pairing” helps you predict the other strand C A C
DNA “complementary strand” Because nucleotides only pair or hydrogen bond with a specific partner (T-A, and G-C), 1 strand of DNA is said to be “complementary” to the other (hence the “law of complementary base pairing”)
DNA Double-stranded molecule 2 nm wide If stretched straight, would be about 2 meters long (on average)!!!! All that DNA is packed into the nucleus, and is dispersed so well that you really can’t see DNA on a light microscope (until the cell is ready to divide)
Nucleus Nucleolus Chromatin
DNA Double-stranded molecule In a normal cell (non-dividing), you can’t really see the DNA per se Very dispersed throughout the nucleus DNA is “condensed” or compacted from the 2 meter length into the nucleus Wrap into structure called “chromatin” Combination of protein, and the DNA wound around it Looks like “beads on a string” More like hockey pucks or discs…with DNA wrapped around them like a spool
Chromatin The chromatin is the whole DNA/protein structure used for compacting the DNA so that it will fit into the nucleus Chromatin DNA Protein
The next step to condensing the DNA is to arrange the histone/DNA in a zig-zag formation Zig-zagging helps compact the DNA more than a straight line of nucleosomes The zig-zag is then coiled into circles Imagine a telephone cord, zig-zagging it, and then wrapping the while thing into more coils/circles DNA compacting/condensation
The ONLY time you can really see the DNA on a light microscope is when the cell is dividing Compacts the DNA even more, and copies the DNA (so that there’s twice as much) DNA compacting/condensation
Watson & Crick vs. Franklin & Wilkins, Watson & Crick are credited with “figuring out” the structure of DNA We knew what made up DNA, but didn’t know how it “looked” or was assembled until they PUBLISHED their “findings” What REALLY happened: Rosalind Franklin gathered the evidence at a nearby college (she was an X-ray technician) Watson & Crick were at Cambridge Franklin & her boss Wilkins were at King’s College Franklin’s boss, Maurice Wilkins, showed Watson their data, and Watson & Crick quickly “published” their idea In fact, they didn’t even have to do any experiments… DNA
Rosalind Franklin The X-ray image of DNA that Rosalind Franklin’s boss took to show Watson Watson & Crick
Remember that the basic function of DNA is the code for proteins Remember that only about 2% of the total DNA actually “codes” for proteins…the rest is important for regulating “access to the code” DNA
The cell makes protein using the code on the DNA, but the DNA never leaves the nucleus The code is copied, and exported into the cytoplasm This copy uses a slightly different form of DNA, called RNA (ribonucleic acid) No deoxy on it Replaces thymine (T) with uracil (U) DNA
Since DNA contains the “genetic code” for every protein in your body, EVERY CELL has the SAME DNA EXCEPT egg and sperm…they only have half (we’ll get to this part later) Cells/tissues throughout your body are different?!?!? Even with the same genetic code, different cells “activate” or use different regions of their DNA Which region or proteins they make depends on the cell itself DNA
DNA directs the RNA copy process after receiving the correct stimulus Hormone stimulus, temperature, stress, age etc. Specific process then uncoils the region of DNA that codes for the protein called for Number of enzymes then “copy” the DNA template for the protein This is when the RNA is assembled The RNA copy is then sent out of the nucleus DNA is then re-coiled Process = “transcription” RNA
RNA Recall “uracil” (U) Only in RNA (ribonucleic acid), which is how the DNA sends it’s protein code out of the nucleus the DNA never leaves the nucleus unless the cell is dividing With RNA, there are NO thymines (T)…they’ve been replaced with Uracil (U) NOT’s in RNA, there are U’s instead of T’s Thus, the “law of complementary base pairing”…. CATAGCTTA on the DNA would be paired with GUAUCGAAU on the RNA molecule
RNA is a single-stranded copy of the coding strand of DNA Unlike DNA, which is double stranded, RNA looks like half a ladder instead of a whole ladder There are 3 types of RNA Messenger RNA (mRNA) This is what is copied from the DNA template Ribosomal RNA (rRNA) This is part of the ribosome (remember that the ribosome is what will translate the mRNA template copy of DNA into a protein) Transfer RNA (tRNA) This is what the ribosome uses to assemble the protein RNA
Protein synthesis pathway Signal/stimulus DNA uncoiling Copy DNA as mRNA Export mRNA to cytosol Ribosomes assemble protein according to mRNA instructions
There are over 2 million different proteins (2,000,000+) in your body All are assembled from only 20 amino acids All 20 amino acids are “coded” for by a mere 4 different nucleotides (ATCG) The “genetic code” permits these 4 nucleotides to tell the cell how to arrange the 20 amino acids into over 2 million different proteins Your computer and cell phone etc. uses a code of 0’s and 1’s to transmit your voice, data etc…similar to your DNA! The genetic code
In order to “code” for amino acids, the 4 nucleotides (ATCG) have to be arranged in a manner to permit at least 20 different combinations (for the 20 different amino acids) Thus, we use a combination of 3 nucleotides to code for 1 amino acid Combinations of 3 nucleotides provides 64 possible different combinations The genetic code
Our genetic code, which codes for every protein in our body, uses a “base” of 3 nucleotides It’s read in 3’s There are 64 possible 3-nucleotide combinations 61 of those combinations actually “refer” to an individual amino acid There are only 20 amino acids! Many amino acids have “duplicate” codes The remaining 3 combinations are “stop” signals The genetic code
The use of 3 nucleotides to “code” for a specific amino acid is known as the “triplet codon” Triplet (for the 3 nucleotides) Codon (“code on” the DNA) Each unique triplet that codes for a specific amino acid is known as “base triplet” The triplet that identifies a unique amino acid “base” Codons
4 particularly important “triplet codes” or base triplets you should know: The universal “start” codon = “AUG” Remember that RNA has no T’s…they’re replaced with U’s On the DNA (your genes), this would be “ATG” The 3 universal “stop” codons UAG, UGA and UAA Remember, on the DNA, these would be TAG, TGA and TAA Codons
Universal start codon tells the machinery where to start interpreting the triplet base code This is important, since starting randomly can lead to a completely different protein The “stop” codons tell the machinery where to stop making the protein Don’t want the protein too long or too short Too long = non-functional…waste of amino acids and energy Too short = non-functional…you’ve wasted amino acids and energy again! Codons
Why a universal start codon? The universal start codon ensures that the CODE on the mRNA (taken from the DNA) is “translated” correctly into the protein that was called for Each protein has it’s own mRNA If you start randomly reading the code, because of the triplet base code system, you’d make a lot of garbage proteins that would be useless Codons
This is a table of the triplet base codon system. Virtually all living forms use coding system to build protein. Notice how the “AUG” triplet code is for “Met” or Methionine. Methionine always the first amino acid in EVERY protein during the translation process. It might be chopped off later, but every protein starts with a Methionine amino acid.
Why is this table such a big deal? • EVERY life form uses this same “triplet codon” system, hence if you know the DNA sequence from a plant, you can predict what the protein will be. • Remember the 3 different forms of RNA? • mRNA is the copied form of DNA (the transcript) • tRNA(transfer RNA) is smaller unit of 3 nucleotides arranged according to the table to the right. • rRNA (ribosomal RNA) tries to take all the different tRNA molecules and complement or match them to the group of 3 nucleotides that it is reading on the mRNA molecule. For every combination of 3 nucleotides in the table above, there is a complementary tRNA molecule. This tRNA molecule will be holding onto a specific amino acid.
Codons Hypothetical mRNA sequence GAUAGCAUGUUAAGAUCCCAG With the universal start codon, this is the triple base that the ribosome will use to assemble the protein 1 2 3 4 5 GAUAGC AUG / UUA / AGA / UCC / CAG Correct protein (amino acid sequence) 1 2 3 4 5 WITHOUT the correct “reading frame”, a completely different code can be “read”…leading to a completely different protein…we don’t want that G / AUA / GCA / UGU / UAA / GAU / CCC / AG 1 2 3 4 5 GA / UAG / CAU / GUU / AAG / AUC / CCA / G
Step 1 = unwind the DNA following a specific stimulus Step 2 = copy the DNA using RNA monomers and the “law of complementary base pairing” (create an mRNA copy transcript) Step 3 = export the mRNA out of the nucleus (remember that the DNA NEVER leaves the nucleus) Step 4 = ribosomes will “read”/translate the mRNA and begin to assemble the protein Transcription & translation
AUGAGGAUUAGA Transcribe a mRNA copy Unwind the DNA OUTSIDE of the nucleus, ribosomes will read the mRNA and assemble the protein
INSIDE the ribosome, you first find the “universal start codon” (AUG) AUGAGGAUUAGA The ribosome then looks for the complementary tRNA (using the “law of complementary base pairs”) AUGAGGAUUAGA UAC tRNA molecule Methionine (amino acid)
The ribosome then looks for the complementary tRNA (using the “law of complementary base pairs”) AUGAGGAUUAGA UAC Methionine (amino acid) The ribosome then looks for the NEXT complementary tRNA AUG AGGAUUAGA UAC UCC Methionine (amino acid) Serine (amino acid)
mRNA is “transcribed” from the DNA Transcription = copying the DNA by mRNA from that DNA template Protein is translated from the mRNA template Translating = interpreting the nucleotide code to make protein Remember: in order to assemble the protein correctly, you have to read the mRNA template in groups of 3 (triplet codon) Transcription vs translation
Good website… http://www.studiodaily.com/main/technique/tprojects/6850.html Follows a number of events within a cell (all computer generated based on the real thing). Try to identify what organelles you see throughout the movie, and one or two of the functions of each organelle.
Cell theory Developed by Robert Hooke after looking at slices of cork through a microscope Theodor Schwann later looked at animal tissues and saw cells as well Was mistaken in his belief that these cells were made of non-living fluid that spontaneously acquired a membrane and nucleus Louis Pasteur finally demonstrated the errors of “spontaneous generation”
Cell membrane Recall the phospholipid A version of triglyceride where 1 fatty acid is replaced with a phosphate The cell “plasma membrane” is the outer “cover” or it’s SKIN Made of phospholipid arranged as a “bilayer” or 2 layers of phospholipid Arranged in opposite pairs: the fatty acid tails face each other, the phosphate groups face outwards
Cell membrane Two (2) important facts about the cell plasma membrane: The phosphate (hydrophilic) part can interact with water. The hydrophobic “fatty acid” part cannot interact with water. Since the middle of the cell membrane is essentially fat (oil), water and many nutrients etc. cannot easily pass across the plasma membrane. These particles must be transferred across the cell membrane by special transport PROTEINS
Aquaporin The scientist who figured this out won a Nobel prize! (P. Agre) More water Plasma membrane Less water J Am Soc Nephrol 15:1093-1095, 2004 Tajkhorshid, E., Nollert, P., Jensen, M.O., Miercke, L.J., O'Connell, J., Stroud, R.M., and Schulten, K. (2002). Science 296, 525-530).
Cell membrane Since the cell membrane is made from phospholipid, molecules must be “chaperoned” or carried across Very few compounds can cross the plasma membrane freely Cells use proteins to transfer proteins, carbohydrates and even lipids from blood-cytoplasm-blood Known as “selective permeability” Most of these “transport proteins” rely on a concentration gradient More molecules on one side of the plasma membrane will favor movement of those molecules to the other side (to equal the concentration)
Cell membrane • Recall aquaporin (water “channel”) • Allows water to pass across the plasma membrane • Water movement (water gradient) = osmosis or “osmotic pressure” • Depends on the number of “solutes” or particles that water surrounds