lani
Uploaded by
67 SLIDES
1370 VUES
710LIKES

ChIP-seq

DESCRIPTION

Institute for Computational Biomedicine. ChIP-seq. Olivier Elemento, PhD TA: Jenny Giannopoulou, PhD. CSHL High Throughput Data Analysis Workshop, June 2012. Plan. ChIP-seq Quality Control of ChIP-seq data ChIP-seq Peak detection Peak Analysis and Interpretation

1 / 67

Download Presentation
Télécharger la présentation

ChIP-seq

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Institute for Computational Biomedicine ChIP-seq Olivier Elemento, PhD TA: Jenny Giannopoulou, PhD CSHL High Throughput Data Analysis Workshop, June 2012

  2. Plan • ChIP-seq • Quality Control of ChIP-seq data • ChIP-seq Peak detection • Peak Analysis and Interpretation • A few interesting ChIP-seq papers

  3. 1. ChIP-seq

  4. ChIP-seq Transcription factor of interest (or histone modification) Antibody Illumina

  5. Control: input DNA Illumina Can use IgG as additional control

  6. ChIP-seq methodology Abcam H3K9Me3 rabbit polyclonal (ab8898) • Identify ChIP-grade antibody, determine specificity (Western, histone peptide array) • Optimize conditions using single-locus ChIP-PCR (positive and negative controls) • Sequence ChIP product using 1 Illumina lane per sample (no TruSeqChIP-seq), single end • Sequence input/IgG as control Assessing the specificity of a commercial H3K9m3 antibody using histone peptide arrays, K. Bunting & B. Swed, WCMC

  7. ACCAATAACCGAGGCTCATGCTAAGGCGTTAGCCACAGATGGAAGTCCGACGGCTTGATCCAGAATGGTGTGTGGATTGCCTTGGAACTGATTAGTGAATTCACCAATAACCGAGGCTCATGCTAAGGCGTTAGCCACAGATGGAAGTCCGACGGCTTGATCCAGAATGGTGTGTGGATTGCCTTGGAACTGATTAGTGAATTC TGGTTATTGGCTCCGAGTACGATTCCGCAATCGGTGTCTACCTTCAGGCTGCCGAACTAGGTCTTACCACACACCTAACGGAACCTTGACTAATCACTTAAG Average length ~ 170bp

  8. 40-100bp ACCAATAACCGAGGCTCATGCTAAGGCGTTAGCCACAGATGGAAGTCCGACGGCTTGATCCAGAATGGTGTGTGGATTGCCTTGGAACTGATTAGTGAATTC TGGTTATTGGCTCCGAGTACGATTCCGCAATCGGTGTCTACCTTCAGGCTGCCGAACTAGGTCTTACCACACACCTAACGGAACCTTGACTAATCACTTAAG Average length ~ 170bp

  9. 40-100bp ACCAATAACCGAGGCTCATGCTAAGGCGTTAGCCACAGATGGAAGTCCGACGGCTTGATCCAGAATGGTGTGTGGATTGCCTTGGAACTGATTAGTGAATTC TGGTTATTGGCTCCGAGTACGATTCCGCAATCGGTGTCTACCTTCAGGCTGCCGAACTAGGTCTTACCACACACCTAACGGAACCTTGACTAATCACTTAAG Average length ~ 170bp

  10. BWA tutorial (for aligning single end reads to genome) • Get genome, e.g., from UCSC • http://hgdownload.cse.ucsc.edu/goldenPath/hg19/bigZips/chromFa.tar.gz • Combine into 1 file • tar zvfx chromFa.tar.gz • cat *.fa > wg.fa • Indexing the genome • bwa index -p hg19bwaidx -a bwtsw wg.fa • Align ChIP reads to reference genome • bwa aln -t 4 hg19bwaidx s_3_sequence.txt.gz > s_3_sequence.txt.bwa • Convert to SAM format • bwa samse hg19bwaidx s_3_sequence.txt.bwa s_3_sequence.txt.gz > s_3_sequence.txt.sam • Align input reads to same reference genome • bwa aln -t 4 hg19bwaidx s_4_sequence.txt.gz > s_4_sequence.txt.bwa • Convert to SAM format • bwa samse hg19bwaidx s_4_sequence.txt.bwa s_4_sequence.txt.gz > s_4_sequence.txt.sam

  11. Reads can map to multiple locations/chromosomes Read 2 Read 1 Reference Human Genome (hg18)

  12. Reads map to one strand or the other Read 2 Read 1 hg18

  13. SAM format DH1608P1_0130:6:1103:10579:166379#TTAGGC 16 chr1 1249828 37 51M * 0 0 GGGCGTGACTCTGATCTCAGGCATCGTCTCCGCCGCGCTCCCGGACCCGCG eb`XXYbZdadee^ceV]X][ccTcc^ebeece eeeWbeeeeeeeceeaee XX:Z:NM_017871,32 NM:i:0 MD:Z:51 DH1608P1_0130:6:1102:3415:150915#TTAGGC 16 chr1 1249828 37 51M * 0 0 GGGCGGGACTCTGATCTCAGGCATCGTCTCCGCCGCGCTCCCGGACCCGCG BBBBBBBBBBBac]bbbceedaeddeZceeea_ba_\_eee eeeedaeeee XX:Z:NM_017871,32 NM:i:1 MD:Z:5T45 DH1608P1_0130:6:1102:13118:62644#TTAGGC 16 chr1 1249828 37 51M * 0 0 GGGCGTGCCTCGGATCTCAGGCATCGTCTCCGCCGCGCTCCCGGACCCGCG BBBBBBBBBBBBBBBBBBBBB`XTbSa`cffegdggeccbe effdeggggg XX:Z:NM_017871,32 NM:i:2 MD:Z:7A3T39 DH1608P1_0130:6:1203:3012:157120#TTAGGC 16 chr1 1249826 25 51M * 0 0 AAGGCCGTGACTCTGATCTCAGCCCTCGTCTCCGCCGCGCTCCCGGACCCG BBBBBBBB^`QWZZ]UXYSZSTFRU]Z__SO[adcc[acdV \`Y]YWY][_ XX:Z:NM_017871,34 NM:i:3 MD:Z:4G17G1A26 DH1608P1_0130:6:2206:4445:12756#TTAGGC 16 chr1 1246336 25 1M3487N50M * 0 0 CCAAAGGGTGTGACTCTGATCTCGGGCATCGTCTCCGCCGCGCTCCCGGAC BBBBBBBBBBBBBBBBBBBBBBBB`YdddYdc\ cacaNddddcdddaeeee XX:Z:NM_017871,37 NM:i:3 MD:Z:2C5C14A27 DH1608P1_0130:6:2203:7903:43788#TTAGGC 16 chr1 1246336 37 1M3487N50M * 0 0 CCCAAGGGCGTGACTCTGATCTCAGGCATCGTCTCCGCCGCGCTCCCGGAC adbe[fbcbccb_cb^cb^^c^edgegggggdf ggefffgfbfggggegeg XX:Z:NM_017871,37 NM:i:0 MD:Z:51 CIGAR string, eg 5M3487N46M = 5bp-long block, 3487 insert, 46bp-long block MD tag, e.g, MD:Z:4T46 = 5 matches, 1 mismatch (T in read), 46 matches XT tag, e.g. XT:A:U = unique mapper; XT:A:R = more than 1 high-scoring matches

  14. Quality Control

  15. Clonal reads http://biowhat.ucsd.edu/homer/chipseq/qc.html

  16. Fragment size analysis

  17. Fragment size analysis

  18. Fragment size analysis using opposite strand autocorrelation http://biowhat.ucsd.edu/homer/chipseq/qc.html

  19. Fragment size analysis http://biowhat.ucsd.edu/homer/chipseq/qc.html

  20. GC-content analysis http://biowhat.ucsd.edu/homer/chipseq/qc.html

  21. GC-content analysis http://biowhat.ucsd.edu/homer/chipseq/qc.html

  22. Other QC measures • Number of peaks: • 0 or very few peaks, even at permissive peak calling thresholds = bad experiment • Motif enrichment • is expected motif enriched in peaks ?

  23. ChIP-seq peak calling

  24. MACS

  25. MACS Estimate d based on high quality peaks 2d The Poisson distribution λ=expected # of reads within an interval of 2d bp # in R P(X>=5|λ=0.001) is 1-sum(dpois(0:4, 0.001))

  26. BayesPeak

  27. BayesPeak (Bayesian Hidden Markov Models) Observed variable Parameters estimated using Bayesian treatment Hidden states

  28. BayesPeak

  29. Peak detection using ChIPseeqer http://icb.med.cornell.edu/wiki/index.php/Elementolab/ChIPseeqer_Tutorial (Elemento and Giannopoulou, 2011)

  30. A nice peak

  31. Not all peaks are that nice

  32. Peak detection • Calculate read count at each position (bp) in genome (we don’t use a sliding window) • Determine if read count is greater than expected (at each position - bp)

  33. Peak detection • We need to correct for input DNA reads (control) - non-uniformaly distributed (form peaks too) - vastly different numbers of reads between ChIP and input

  34. Use Bioanalyzer (remove adapter lengths) genome Read count Expected read count T A T T A A T T A T C C C C A T A T A T G A T A T genome Expected read count = total number of reads * extended fragment length / chr length

  35. Is the observed read count at a given genomic position greater than expected ? Read counts follow a Poisson distribution Frequency x = observed read count λ = expected read count Read count The Poisson distribution

  36. Is the observed read count at a given genomic position greater than expected ? x = 10 reads (observed) λ = 0.5 reads (expected) genome P(X>=10) = 1.7 x 10-10 log10 P(X>=10) = -9.77 -log10 P(X>=10) = 9.77 The Poisson distribution # in R P(X>=10|λ=0.5) is 1-sum(dpois(0:9, 0.5))

  37. Read count Expected read count -Log(p) Expected read count = total number of reads * extended frag len / chr len

  38. Read count Expected read count -Log(p) Expected read count = total number of reads * extended frag len / chr len Input reads

  39. ChIP INPUT Read count Read count Expected read count Expected read count Genome positions (bp) Genome positions (bp) -Log(Pc) -Log(Pi) Threshold [-Log(Pc)] - [-Log(Pi)]

  40. Normalized Peak score (at each bp) P(XChIP) R = -log10 P(Xinput) Will detect peaks with high read counts in ChIP, low in Input Works when no input DNA ! (x=0)

  41. Mappability

  42. Non-mappable fraction of the genome • chr18 9369067/76117153 0.123087459668913 (=12%) • chr2 33849240/242951149 0.139325292921335 • chr3 27854877/199501827 0.139622164963933 • chr4 27090014/191273063 0.141630052737745 • chr6 24330283/170899992 0.142365618132972 • chr8 20932821/146274826 0.143106107677065 • chr5 26029902/180857866 0.143924633059643 • chr12 19382853/132349534 0.14645199279659 • chr11 20039443/134452384 0.149044906485258 • chr20 10017788/62435964 0.160449000194824 • chr7 26182588/158821424 0.164855517225434 • chr10 22968951/135374737 0.169669404417753 • chr17 14496284/78774742 0.184021980040252 • chrX 31269270/154913754 0.201849540099583 • chr1 55186693/247249719 0.223202247602959 • chr13 28668063/114142980 0.251159230291692 • chr16 23552340/88827254 0.265147676410215 • chr14 29689825/106368585 0.279122120502026 • chrM 4628/16571 0.279283084907368 • chr9 43125838/140273252 0.307441635415995 • chr19 20251255/63811651 0.317359834491667 • chr15 31877970/100338915 0.317702957023205 • chr21 16867677/46944323 0.359312392256674 • chr22 21176578/49691432 0.426161556382597 • chrY 43209644/57772954 0.747921665906161 (=74%) We enumerated all 30-mers, counted # occurrences, calculated non-unique fraction of genome Unique/mappable fraction = 1 – non-unique fraction

  43. Read count Expected read count -Log(p) Expected read count = total number of reads * extended frag len / ( chr len * mappable fraction)

  44. Peak detection • Determine all genomic regions with R>=15 • Merge peaks separated by less than 100bp • Output all peaks with length >= 100bp • Process 23M reads in <5mins

  45. BCL6 ChIP-seq • Lymphoma cell line (OCI-Ly1) • Illumina • 6 GA2x lanes for ChIP, 1 for input DNA, 1 for QC • 36nt long sequences • 32 Million reads • Aligned/mapped to hg18 with BWA With Melnick lab at WCMC

  46. BCL6: 18,814 peaks ChIP reads Input reads Detected Peaks 80% are within <20kb of a known gene

  47. Loading peaks into GRange system(“split_samfile s_1_sequence.txt.sam –outdir CHIP/”) system(“split_samfile s_2_sequence.txt.sam –outdir INPUT/”) system(“ChIPseeqer.bin –chipdir CHIP –inputdir INPUT –t 15 –fold 2 –outfile peaks.txt”) tpeaks = read.table(paste(dataFolder, ”peaks.txt”, sep = ""), header = F) peaks = RangedData(ranges = IRanges(start = tpeaks[, 2], end = tpeaks[, 3]), space = tpeaks[, 1], summit = tpeaks[, 6], score = tpeaks[, 5]) ...

  48. Other peak finders

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer