lavonn
Uploaded by
51 SLIDES
637 VUES
510LIKES

Eukaryotic & Prokaryotic Replication: Key Differences Unveiled

DESCRIPTION

Discover the intricate details of DNA replication in eukaryotes as compared to prokaryotes. Learn about the critical differences, enzyme functions, initiation process, and more.

1 / 51

Télécharger la présentation

Eukaryotic & Prokaryotic Replication: Key Differences Unveiled

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. PHAR lecture 5 Replication: Differences between eukaryotes and prokaryotes

  2. Replication in Eukaryotes • Replication is intimately linked to cell division • Cell division in eukaryotes is known as the cell cycle; this will be covered in a later lecture. • It takes some 18 – 24 h to complete. • There are checkpoints along the process.

  3. The cell cycle

  4. The cell cycle consists of: • G1 = growth and preparation of the chromosomes for replication • S = synthesis of DNA (and centrosomes) • G2 = preparation for M • M = mitosis

  5. The cell cycle : • When a cell is in any phase of the cell cycle other than mitosis, it is often said to be in interphase (G1, S or G2). • If a cell is not dividing it is said to be in G0. Terminally differentiated cells are in G0.

  6. Checks before replication • As the cell passes through each phase of the cell cycle there are checkpoints. If something goes wrong the cell division process can be aborted. • If the cell remains in this aborted or arrested state for too long it will be directed to commit suicide, a process known as apoptosis

  7. Check for replication • There is a commitment point late in G1. After that there is no turning back, the cell is committed to cell division. • This point is known as the restriction point. • Extracellular factors; mitogens and protein growth factors must be present. These factors regulate proliferation

  8. Check for replication • DNA damage is checked for at G1 before the cell enters S • A check for the completion of S phase (replication) is the presence of Okazaki fragments. • Spindles are checked before the cell actually divides (M phase)

  9. Cyclins • At critical stages, G1, S and M, special cytoplasmic proteins known as cyclins increase in concentration then subside once the cell has passed through that stage.

  10. Checks before replication • There are also a group of enzymes known as cyclin dependent kinases (cdks) which phosphorylate protein targets involved in the control of the cell cycle. • The catch is that, although the Cdks are present at fairly steady concentrations in the cell independent of the cell cycle stage, they only become activated when they bind the appropriate cyclin.

  11. Drives the cell from G1 to S Cyclin A Binds to Cdk2 & 1 Cyclin E Binds to Cdk2 Cyclin D Binds to Cdk4 & 6 Cyclin B Binds to Cdk1 Cdk levels G1 S G2 M Drives the cell from G2 to M Activity Concentration

  12. Similarities between prokaryotic and eukaryotic replication • More similarities than differences • Bi-directional process • DNA polymerases work 5’ to 3’ • Leading and lagging strands • Primers are required

  13. Differences in Replication • Linear chromosomes Ends or telomeres • More genetic material; eukaryotic cells have on average 50 times more genetic material • More packaging, nucleosomes and nuclear scaffolds • Different enzymes; they are slower!

  14. Eukaryotic replicating Enzymes • Despite the large increase in genetic material eukaryotic DNA polymerases work much slower NOT faster!! • At the rate they work it would take 30 days to copy the human genome if it was left to 2 replication forks! • The unpacking and repacking with histones could account for the slow pace.

  15. Eukaryotic replicating Enzymes • The average E. coli replication fork works around the chromosome at a staggering 105 bases per minute. • Our eukaryotic counterpart can only manage somewhere between 500 and 5 000 bases per minute. • The major enzymes are DNA polymerase a, d and e.

  16. Eukaryotic replicating Enzymes • To get around these slack work habits we have multiple initiation sites. • These sites are scattered around the genome 30 to 300 kb apart. Humans have some 20,000 separate initiation sites. • The whole replication process does not happen simultaneously.

  17. Eukaryotic replicating Enzymes • Clusters of 20 to 80 sites are initiated at a time • Forks extend in both directions from each site. • Replication takes place throughout S phase and takes several hours.

  18. Initiating replication • Each origin of replication must have a protein complex bound to it; imaginatively named the Origin Recognition Complex (ORC). • This complex will remain on the DNA throughout replication.

  19. Initiating replication • Other protein factors will then bind to the ORC and recruit proteins which coat the DNA. • This process is essential for replication. • These accessory proteins or licensing factors accumulate during G1 of the cell cycle.

  20. Initiating replication • The initiation event must be licensed or allowed. • It must also be prevented from re-initiating the process until that round of cell division has finished. • Licensing factors have a role in allowing the initiation and preventing re-initiation.

  21. The start! The parent DNA about to embark on replication Multiple initiation sites form along the DNA, ORC +other licensing factors. The human genome will have some 20,000 such sites often activated in clusters. These multiple origins of replication separated by only 30-300 kb and clustered in groups of 20-80 in various regions of the DNA.

  22. The ends! The parent DNA about to embark on replication Let’s focus on the end working from the last initiation site.

  23. The ends! 5’ 3’ 5’ 3’ RNA primer Newly synthesised DNA strand, the arrow head is the 3’ OH

  24. The ends! 5’ 3’ 5’ 3’ RNA primer removed Newly synthesised DNA strand, the arrow head is the 3’ OH

  25. The ends! 5’ 3’ 3’ 3’ 5’ 3’ Gaps filled in from the 3’ end No 3’ end to fill in from Newly synthesised DNA strand, the arrow head is the 3’ OH

  26. The ends! 5’ 3’ 5’ 3’ Known as the end problem RNA primers removed Newly synthesised DNA strand, the arrow head is the 3’ OH

  27. The ends! 5’ 3’ 3’ 5’ Overhangs at the 3’ end of the parent strand 5’ 3’ 3’ 5’ Newly synthesised DNA strand Parent DNA strand

  28. The ends! 5’ 3’ TTAGGG AAUCCCAAU 5’ 3’ 5’ 3’ Telomerase, containing an RNA component. This enzyme was discovered by an Australian scientist, Elizabeth Blackburn.

  29. The ends! 5’ 3’ TTAGGGTTA AAUCCCAAU 5’ 3’ 5’ 3’

  30. AAUCCCAAU The ends! 5’ 3’ TTAGGGTTA 5’ 3’ 5’ 3’

  31. AAUCCCAAU The ends! 5’ 3’ TTAGGGTTAGGGTTA 5’ 3’ 5’ 3’

  32. AAUCCCAAU The ends! TTAGGGTTAGGGTTA 5’

  33. AAUCCCAAU The ends! TTAGGGTTAGGGTTAGGGTTA 5’

  34. The ends! 3’ TTAGGGTTAGGGTTAGGGTTA 5’ The 5’ strand then extends by lagging strand mechanisms. We still have an overhang on the 3’ end which often tucks in and caps the end. Special capping proteins bind to the ends to protect the ends from nucleases.

  35. Telomerases • Telomerase activity is high in germ-line cells; the zygote starts with full length telomeres. • Somatic cells do not usually have any telomerase activity • Apart from germ-line cells, the highly proliferative stem cells are the only other normal cells to have high telomerase activity

  36. Telomerases If most somatic cells do not have telomerase activity then: • Every time the somatic cell undergoes mitosis the telomere shortens • Eventually the telomere gets too short and the cell is in danger of eroding coding genes • This is known as the Hayflick limit

  37. Telomerases • Human cells start with ~10,000 base pairs on their telomeres at birth. • This enables some cells to survive for an entire life time of replication erosion without suffering cell death. • Telomeres could be a limiting factor in determining an organism’s life span.

  38. Telomerases and Immortality • This explains why normal eukaryotic cells only undergo a certain number of cell divisions in culture before they die. • Immortal cells however, such as cancer cells continue to divide • Whereas normal cells typically don’t have telomerase activity, cancer cells invariably do! They are selected for it! Otherwise they would die out very quickly with the rapid cell division.

  39. Immortal cells. • The most famous immortal cells would have to be HeLa cells. • HeLa cells are derived from Henrietta Lacks who died in 1951 of cervical cancer. • Her cervical cells have survived her by ~50 years. • They continue to be used as the model cell line.

  40. Telomeres and aging • This programmed number of cell divisions means our normal cells progress to terminal differentiation and turn over. • This shortening of the telomeres is thought to be responsible in the end for the organism’s aging. • Aging may be a protective mechanism against uncontrolled proliferation or cancer.

  41. Telomeres and aging • When they cloned Dolly the sheep (1996 – 2003) they inserted old DNA into Dolly’s nucleus. • The process involved removing the genome in the zygote (fertilised egg) and replacing it with a different genome. • Dolly literally was a clone of the genome donor.

  42. Dolly the sheep

  43. Dolly the sheep Dolly’s death 2003 Birth of Bonnie, Dolly’s lamb 1996: Birth Sheep have a life expectancy of 10 to 20 years, averaging 12 years. Poor Dolly lasted 6 years.

  44. Telomeres and aging • Why did Dolly die early? Because the DNA inserted had shorter telomeres and was already well on the way to getting old. • She was euthanased in 2003 at 6 suffering from a lung infection and arthritis; characteristics of older sheep. • Likewise sufferers of Progeria, the aging disease are born with short telomeres.

  45. Progeria • Progeria is the premature aging disease • It is described as a sporadic autosomal dominant mutation • There are 2 types; Werners syndrome (adult-onset progeria, average life span 47 years) and Hutchinson-Gilford progeria (juvenile-onset progeria, average life span 13 years)

  46. Progeria • Hutchinson-Gilford progeria is the result of a T  C substitution in the gene LMNA • This gene codes for a protein lamin A which is normally found in the nucleus. • The mutation causes a splice problem  defective laminA (50 aa shorter) and the mutant protein (progerin) stays attached to the nuclear membrane

  47. Progeria • From the point of view of telomerases…. • Some of the cells from Hutchinson-Gilford patients are prone to early cell senescence. • “Hutchinson-Gilford children show what appears to be early aging of their skin, bones, joints, and cardiovascular system, but not of their immune or central nervous systems.” • Skin fibroblasts from Hutchinson-Gilford patients have shorter than normal telomeres and consequently undergo early cell senescence.

  48. Progeria • At birth, the mean telomere length of these children in certain cells is equivalent to that of a normal eighty-five-year-old. • Introduction of telomerase to these cells in culture restores their telomere length and immortalises them in culture.

  49. Progeria • To quote the web “Clinical interventional studies using this strategy in humans are pending”. • Other cells unaffected by the disease have normal length telomeres e.g. lymphocytes. • They die of cardiovascular disease or stroke BUT they do not suffer dementia or suffer from increased infections.

  50. This five year old boy has Hutchinson-Gilford progeria, a fatal, "premature aging" disease in which children die of heart failure or stroke at an average age of thirteen. Photo courtesy of The Progeria Research Foundation, Inc. and the Barnett Family.

More Related