40 likes | 102 Vues
Explore a comprehensive analysis of BRCA2 Large Genomic Rearrangements (LGRs), elucidated by Homologous Recombination or microhomology events, showcasing the mutated alleles and their genomic locations.
E N D
g.41599 g.42421 Intron 13 -CCTTGGCCTCCCAAGGTGCTGGGATTACAGACGTGAGCCACTGTACCAGGCCTAATGTTAC GCCTTGGCCTCCCAAAGTGCTGGGATTACAGGCTTGAGCCTGTAAATCCAGAAAAGGATT-- ************** *************** * ****** * * * * * ** Del 14-18 (g.41600_57818del) Intron 13 Intron 18 --GATTTGGCCAGATAGTGATAAGTTGAGACTG-GCAAATTATTTCCACTTAGATTTAAATATA-- GTTGTATTATTTTCTCGTACTAAAT--AGACTGCATAAGGTAGA---AGTTAAGAATGATTGCCCT * * * ** *** * ****** ** ** * *** * * * Del E14-E16 (g.42422_49277del) Intron 16 g.57819 g.49278 g.31193 g.48896 -GATCACGAGGTCAGGAGATCGAGACCATCCCGGCTAAAACGGTGAAACCCCGTCTCTACTA GGATCACAAGGTCAGGAGATCGAGACCATCCTGGCTAACATGGTGAAACCCCATCTCTACT- ****** *********************** ****** * *********** ******** Intron 11 Del E12-E13 (g.31194_40076del) Intron 13 AAATATAAATAAACACTAAAAGTTAAACAGAAATATTTGAATA--TCAATAATGCCAAATAACTAGAAAATCT GAACTTG---TAGCAGTA-----TAAACA-ATATGTTTGAGAAGTACTATATTGTGAAAATATTT---TCACT ** * * ** ** ****** * ** ***** * * *** ** *** * ** Intron 16 Del E17-E18 (g.48897_59728del) Intron 18 g.40077 g.59729 Fig S1. Alignment analysis. Representative examples of BRCA2 LGRs explained by Non Allelic Homologous Recombination(top) ormicrohomology (botton) events. Boxes indicate microhomology regions. The sequence of the mutated alleles is indicated in bold.
g.3792 5’Upstream --CTATCTGC-ATTAGTAAGGCCTCCTT-CTACAACTAAGGATTACTGATTATCAAACTAAAATG AGAAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCT--ATCTCTACTAAAAATACAAAAA-- * ** * ** **** * * * *** ** ** * * * ** **** Del E1-E2 (g.3793_6539delinv:g.5229_5246) Intron 2 g.6540 g.5669 Intron 1 TAACTGGAGCCCTCTGTCCCCACTAGCCACGCGTCACTGGTTA-GCGTGATTGAAACTAAAT--- -CAGTACGTCACAGTGTTGCTTAGAACCATAAACTGTTCCTTATGTGTGTATAAATCCAGTTAAC * * * * *** * * *** * *** * *** * ** * * * Del E2 (g.5670_6155delinsATA) Intron 2 g.32050 g.6156 GTCATTTGACAGGGATATATGTTCTGAGAAATAGATTGTTAGATTTCATCATTGTGGGAAC-- -ACACTT-ACTTCATGTTTTCTTTCATTATATATTTTAATGGATACAAAATATAAATAAACAC :** ** **: .: :*:* ** .: *:*** :**.:*.***: .*:.::*.:. .*** Del E12-E16 (g.32051_48841delinsTAG) g.48842 Intron 11 Intron 16 g.68462 Intron 21 ---TTAGTTGTCCCCTTTGT--GCCTCAGTTT---TACCTACAACACAGAAACAATGATATTACCTACCC TCCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGTGCCT--GGC-CAGAGTCAA-GCTTTTATTT---- * ** ** ** * ** * *** * **** *** * * *** * Del E22-E24 (g.68463_70347del) Intron 24 g.70348 Fig S2. Alignment analysis. None of the four BRCA2 LGR characterized in the present study can be explained by non allelic homologous recombination or micro-homology events. Boxes indicate nucleotides coincident with insertions observed at the breakpoints. The role of these particular nucleotides (if any) in the genomic event leading to the rearrangement is unknown. The sequence of the mutated alleles is indicated in bold.
Del E1-E2 (g.4093_6446delins12) g.4092 5’Upstream -ATCCGAATCCTAAGAATGCAAAAGATGGGCCGGGTGTGGTGGCTCATGCCTGTAATCCCAG------ AATTTAAAAC-TAAGAATTTAA------GGCTGGGCGTGGTGGCTCACGCCTGTAATCCCAGCACTTT ** ** * ******* ** *** *** *********** ************** Intron 2 g.6447 Del 15-16 (g.45679_48141del) g.45678 ---CTCCTCCCGAGTT-CA-AGTGATTCTCCTGCCTCAGCCTGCTGAATAGCTGGGATTACAGGCA GAGACCAGCCTGGGCAACATGGTGAAAACCC-ATCTCTACAAACAAATTAA--AAAATTA--GCCC * ** * * ** **** ** *** * * * ** **** * * Intron 14 Intron 16 g.48142 Fig S3. Alignment analysis. Non allelic homologous recombination is not supported by alignment analysis, despite the fact that breakpoints are located at Alu sequences in both cases. The sequence of the mutated alleles is indicated in bold. In the case of Del E1-E2 (g.4093_6446delins12), the 12-bp insertion was indeed supporting a non-homologous event.
g.7673 Del E3 (g.7674_11736del) Intron 2 ----GGCTACTAGTATTAGTTTGGTGCCACTGCCATAAC-TCATGCAAATGTGCCAGCAGTTTTAC---- TTTTTACTGTCTGTAT-AGTTT--TGCCTTTTCCAGAATGTCATGTAGTTGG------AATCATACAGAA ** **** ***** **** * *** ** ***** * ** ** *** Intron 3 g.11737 g.60521 TCATCTGGATTATACATATTTCG-CAATGAAAGAGAGGA----AGAAAAGGAAGCAGCAAAATATG ---GCTGTTTGATA-GCATTTTATCCATGGTAGAACTGCTTTCATAATTGGAGTCAATTCTATCA- *** * *** **** * *** *** * * ** *** ** ** Del E20 (g.60522_61677del) g.61678 g.31404 Exon 20 g.37616 Del E12-E13 (g.31404_37615delins(A)~60) Intron 20 Intron 11 -GCGAGACTCCGTCTCAAAAAAAAAA----AAAAAGTTGGTTTCCGATTATACCATTTACTGGGTA AATAAGAACAAGTTGCTATAAAAAGCTCTTAGAAATTAAAAATATGATAGCACAAATAAAT----- *** ** * * ***** * *** * * *** ** * * * * Intron 13 g.16098 Del E7-E11 (g.16099_30416del) ATCCTGATATGTCTTGGTCAAGTTC---TTTAGCTACACCACCCACCCTTAGTTCTAC-TGTGCT --AGTGTCACTTGTTGAGAACATTCATGTTTTGGGAAAAGAACAGGCTTCACCTAAAAACGTA-- ** * * *** * *** *** * * * * * * * * * * ** Exon 7 Exon 11 g.30417 Fig S4.Alignment analysis. Four BRCA2 LGR likely explained by micro-homology. The evidence is weaker in the case of DelE7-E11. However, a hypothetical variant present in the ancestral allele (g.30415 T>A), will make the micro-homology event more plausible. The sequence of the mutated alleles is indicated in bold.