1 / 34

First Semester Exam Review Topics – Life Characteristics

First Semester Exam Review Topics – Life Characteristics. NOT ALIVE!. ALIVE!. Biology is all about being Alive! Know what that means!. O – H – M – R – G&D – E&A. First Semester Exam Review Topics – Pyramids. All about Energy! Who has the energy? Where from? How?

lbartley
Télécharger la présentation

First Semester Exam Review Topics – Life Characteristics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. First Semester Exam Review Topics – Life Characteristics NOT ALIVE! ALIVE! Biology is all about being Alive! Know what that means! O – H – M – R – G&D – E&A

  2. First Semester Exam Review Topics – Pyramids All about Energy! Who has the energy? Where from? How? How much flows “upwards” between the levels? Can you Name the Levels? What is wrong with this Diagram?

  3. First Semester Exam Review Topics – Food Webs What are these Illustrations Called? Know the energy levels, -vores, -trophs, niche, etc… What would happen if the area was sprayed the area and the Herbivorous Insects were wiped out? What is the Spider? Fox?! Rabbit? Why is the Toad the most fragile animal here?

  4. First Semester Exam Review Topics - Symbiosis One Consumes the other!   Both Benefit!  One Benefits without affecting the other!  One Benefits at the expense of the other!

  5. First Semester Exam Review Topics – Limiting Factors Limiting Factors and Seasons that support/control the Producers. What do the Producers require to Thrive?!

  6. First Semester Exam Review Topics – Population Growth  Balance  Small populations are in danger because: (?)

  7. First Semester Exam Review Topics – Human Population Remember! Growth Rate (GR) = Birth Rate (BR) – Death Rate (DR) Age Structure Graph Shows the pattern of growth of a population. How many offspring = How fast the Population will grow! Developing Country = Fast Growing Pop. Slow Growing Developed Country. Developed Country = Stable Zero Growth.

  8. First Semester Exam Review Topics – Carbon Cycle ?! Photosynthesis collects CO2 vs. Cellular Respiration releases CO2 in rough Balance to maintain atmospheric levels.

  9. First Semester Exam Review Topics – Global Warming Rapid and Recent Increase in the average temperature of the Earth following the beginning of the Industrial Revolution. Linked to the release of CO2 into the atmosphere which absorbs radiation and traps heat. Excess CO2 results from Combustion of fossil fuels. All related to the Greenhouse Effect.

  10. First Semester Exam Review Topics – Nitrogen Cycle Why is Nitrogen essential to all living things? What form does that Nitrogen need to be in to become available to the Food Web? What important plants are especially important in the Nitrogen Cycle and what do they have?

  11. First Semester Exam Review Topics – Bioaccumulation Pollution affects organisms when it become concentrated enough to damage them. Producers collect a little of the toxic chemicals, but the higher organisms in the Food Web end up with toxic levels. Who is affected? Where is the Toxic Chemical Stored? How did the environment become exposed? Why did the Producers not die?

  12. First Semester Exam Review Topics – Dead Zones Ecosystems SHOULD be in rough Balance! If there is an over-abundance of Nutrient Run-off from farmlands, the algae “Bloom” and this leads to loss of Oxygen – Dead Zones! Nutrients cause too much Algal Growth, leaving too much dead algae! Decomposers then Overgrow and use the Oxygen!! Red Tide does Something Else! Toxic!

  13. First Semester Exam Review Topics – Organic Compounds Living Things are mostly composed of Organic Compounds. Organic mean Based on CARBON!! Carbon is the BFF that holds all of the various atoms together. Bonds in three dimensions and can form highly complex, large molecules. C Typically, other elements involved in Organic Molecules include H,N, and O = 96+% of all living matter!

  14. First Semester Exam Review Topics – Organic Compounds There are four (4) basic types of Organic Compounds. CARBOHYDRATES are Sugars and are universal energy sources! Photosynthesis!! LIPIDS are Fats and are good for energy storage! Triglyceride with three Fatty Acids. Monosaccharides such as Glucose = Blood Sugar! Benedict’s Test turns Orange P Phospholipid found in Membranes. Polysaccharides that store glucose and thus energy. Starch stores energy in Plants – Iodine test = Black. Cellulose in Cell Walls of Plants. Glycogen stores energy in Animals. Lipids are Non-Polar and do not dissolve in Water = Insoluble. Brown Paper Bag Test!!

  15. First Semester Exam Review Topics – Enzyme

  16. First Semester Exam Review Topics – Plasma Membrane ? Receptor for Information and Control of the Cell ? Phospholipid Bilayer Barrier. ? Selective Permeability and Homeostasis!

  17. First Semester Exam Review Topics - Prokaryotes How do you KNOW that it is a “Pro” karyote?

  18. First Semester Exam Review Topics - Eukaryotes Must Know! Nucleus, Plasma Membrane, Mitochondrion, Food Vacuole, Ribosome and what they do! Also Must Know! Cell Wall, Vacuole, Chloroplast and what THEY do!

  19. First Semester Exam Review Topics – Cell Organization Cell Cell Organize into Cell Cell Cell Cell TISSUES Cell Cell Cell Organize into Epithelial Blood Muscular ORGANS Nervous Connective ORGAN SYSTEM ORGANISM ORGAN SYSTEM ORGAN SYSTEM Organize into ORGAN ORGAN ORGAN Organize into ORGAN SYSTEM

  20. First Semester Exam Review Topics - Osmosis Movement of Water to maintain Equilibrium. Uncontrolled. Low concentration of solutes = lots of water! 0% Higher concentration of solutes = less water! i.e., 10%

  21. ATP! First Semester Exam Review Topics – Membrane Transport Active Transport always forces from Low ↓ High Need ATP to move “against” the conc. gradient. Passive Transport always flows High ↓ Low “with” the conc. gradient.

  22. First Semester Exam Review Topics - Photosynthesis Plants Require CO2 and H2O!!! They then use those Reactants to produce Glucose!! Stomata Control Everything since they determine TRANSPIRATION and delivery of the Reactants!!

  23. First Semester Exam Review Topics – Cellular Respiration Fermentation in cytoplasm If O2 present = Aerobic! Efficient / Eukaryotes / Oxygen! Inefficient / Yeast and Bacteria / Sealed Up. If O2 NOT present = Anaerobic! 2 ATP 36-38 ATP!

  24. NH2 N N Adenine N N P P P First Semester Exam Review Topics – ATP Adenosine Triphosphate. THE Basic Energy Carrying Molecule of Cells. Can pass energy on to other molecules to drive Metabolism via the third Phosphate Group. Cycles back and forth with ADP. ADP Metabolism Respiration ATP! Universal Energy Source means that Enzymes and various Chemical Reactions can become specialized to use THIS molecule. Little Variation = Same Shapes!

  25. First Semester Exam Review Topics – Fermentation Fermentation is Anaerobic!! Useful Process for many different Foods. All are sealed during their Production! Lactic Acid Fermentation leaves a sour taste as the pH changes – Goes Down!! Alcoholic Fermentation produces CO2 = Bubbly!! Psst!! CO2! Fluffy with CO2 holes!! Remember! What happens to Muscle as a result of Lactic Acid Fermentation?

  26. First Semester Exam Review Topics – DNA Structure DeoxyriboNucleic Acid THE Genetic Material carries Information of the Organism. Stable as a Double Helix protecting the information on the Inside. Building Blocks are Nucleotides. Bases represent the information and always form Complementary Base Pairs. A  T G  C Complementary Base Pairs! If DNA Strand G C T A T T C G C A C G T A A C G T A Other Strand is C G A T A A G C G T G C A T T G C A T This Illustration shows the copying of DNA. What is this process called and what is the final product? Why is it “Semi-Conservative”?

  27. First Semester Exam Review Topics – RNA How is RNA different from DNA: Structurally? Bases? Function? Location? What is this Process called? What is the Original Sequence Called? If DNA Strand G C T A T T C G C A C G T A A C G T A RNA Strand is C G A U A A G C G U G C A U U G C A U

  28. First Semester Exam Review Topics – Protein Synthesis DNA Transcription RNA Translation Protein

  29. First Semester Exam Review Topics - Translation GGAATGCCAGCGAAAAATGCCCATTAA CCTTACGGTCGCTTTTTACGGGTAATT GGAAUGCCAGCGAAAAAUGCCCAUUAA Met Pro Ala Lys Asn Ala His STOP NOW – Have an Amino Acid Chain. What has to happen to get a functional Protein? mRNA Genetic Code

  30. First Semester Exam Review Topics - Mutation CAG ↓ Q = Glu CAA ↓ Q = Glu Same = Silent AAG ↓ K = Lys Problem! TAG ↓ STOP Disaster! Delete AG ↓ Only 2?! Disaster! Usually caused during Replication (=Error) OR as a result of exposure to damaging Mutagens (=radiation, chemicals, etc…). Random and Constant. Usually caused during Meiosis! Random!

  31. First Semester Exam Review Topics – Cell Cycle The Production of new cells should be tightly controlled! Daughter Cells are only made when there is space during Growth and Healing. Cells have to “shut-down” DNA as Chromosomes! Most Cells Do Not Divide as they are specialized to function. G0 cells are “working” and typically cannot do Mitosis. DNA is Chromatin and in Use! In Mitosis, all of the Daughter Cells are Genetically Identical (barring Mutation), but since they “Express” different genes in different ways, they can “Differentiate” into very different cellis: e.g., Muscle and Nerve Cells that are very active (lots of Mitochondria!), or Connective Tissue Cells, etc…

  32. First Semester Exam Review Topics – Cancer The Cell Cycle is controlled by Genes just like everything else! If those genes are mutated, then the Cell Cycle will be affected. Those Daughter Cells SHOULD stop growing when they contact each other (Contact Inhibition!) and then shift to G0 and get to Work!. IF the Cell Cycle is disrupted (e.g., by mutated Oncogenes), this process cannot stop when it SHOULD! Cancer is caused by Mutation. Major causes include UV Radiation (Ozone is Important!!), Smoking (Don’t do it!), Viruses (new vaccines can prevent!), and Replication Errors (No Fix There).

  33. First Semester Exam Review Topics – Cell Division/Mitosis Controlled growth. UNControlled growth.

  34. First Semester Exam Review Topics – Cell Division/Mitosis Asexual Identical Clone Daughter Cells Growth/Dev. Do not need to know the four Phases, but need to be able to recognize the parts and put the phases in order.

More Related