Genetic Code
The genetic code consists of triplets The group of three nucleotides that together encode one amino acid was named a codon The genetic code is non-overlapping. Genetic Code. Remaining questions about the genetic code
Genetic Code
E N D
Presentation Transcript
The genetic code consists of triplets The group of three nucleotides that together encode one amino acid was named acodon The genetic code is non-overlapping Genetic Code
Remaining questions about the genetic code Does the code have codons that are not translated? (Is the code punctuated?) Does each codon specify more than one amino acid? (Is the code ambiguous?) Are the amino acids encoded by more than one codon? (Is the code degenerate?) Is the code the same in all organisms? (Is the code universal?) Genetic Code
Deciphering the genetic code Synthesized artificial RNA and then translated them into proteins Genetic Code • Polynuceotide • phosphorylase • NDPs -------------------- RNA + Pi • Translated the artificial RNAs in a • cell-free protein synthesizing system
Homopolymer was then added to a test tube containing cell-free translation system, 1 radioactively labeled amino acid and 19 unlabeled amino acids Proteins were isolated and checked for radioactivity Procedure was repeated in 20 tubes, with each tube containing a different radioactively labeled amino acid Only one tube contained radioactively labeled protein; the amino acid that was labeled (phenylalanine) is therefore specified by UUU
The first one synthesized was poly U (UUU) Found that the polypeptide only contained phenylalanine AAA = only lysine (poly-lysine) CCC = only proline (poly-proline) GGG = only glycine (poly-glycine) Genetic Code
Next synthesized heteropolymers The artificial RNA sequence would depend upon the ratio of the two or more NDPS added ADP and CDP in a 1 to 5 ratio 1/6 probability of incorporating an A being incorporated 5/6 probability of incorporating a C being incorporated The resulting RNA molecule would be a collection of different codons that are made-up of A and C The numbers of different codons in the RNA molecule is a matter of probability Genetic Code
Genetic Code ADP and CDP added in a 1 to 5 ratio AND if codon is a triplet
Genetic Code The poly (AC) RNAs produced proteins containing 6 amino acids 2C:1A (11.6%) 1A : 2C (11.6%) 2A : 1C (2.3%) 1A : 2C (11.6%)
Does the code have codons that are not translated? (Is the code punctuated?) Yes! The code is punctuated with periods, not commas 61 codons code for amino acids 3 codons are stop or nonsense codons UAG (amber) UGA (opal) UAA (ochre) Genetic Code
Does each codon specify more than one amino acid? (Is the code ambiguous?) NO!! Each codon codes for only one amino acid Genetic Code
Are the amino acids encoded by more than one codon? (Is the code degenerate?) YES!!! Most amino acids are encoded by more than one codon There are certain patterns of degeneracy The first two bases the same, the third one changes Genetic Code
Is the code the same in all organisms? (Is the code universal?) At first, YES!!! Now we know there are a few exceptions A few different codons in mitochondria Genetic Code
Using the table below, can you translate this nucleotide sequence? 5’UUCGAUGCCCGGGGUCCUGAAAUUGUUCUAGA 3’ • The first step is to look for the AUG start codon. • Next, group the nucleotides into a reading frame of 3 nucleotides per codons and use the table to find the amino acid that corresponds to each codon. • Stop translating the mRNA when you reach a stop codon. • Is this what you got? Met-Pro-Gly-Val-Leu-Lys-Leu-Phe-Stop