1 / 17
Télécharger la présentation

Evaluation of Fungal Genomics and Snails and Parasites in Housekeeping

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Today • House Keeping • Course Evaluation • Current standing (talk to Coen) • Report writing • Two *.ppt • Minion and fungal genomics • Snails and parasites, Genbank submissions

  2. REPORTS in PDF format • Due 23.59h, Tuesday December 11th Grading Key for final report • Correct format (order/spacing/legends/etc.) • Correct methods • Basic results • Appropriate references • Discussion (analysis) 30% 20% 20% 15% 15% • 25% of final grade for 446L (100/400) • 20% of final grade for 546L (100/500)

  3. *.ppt

  4. *.ppt

  5. Fungal genomics

  6. http://mitos.bioinf.uni-leipzig.de/result.py?hash=xQ93ZHDS http://mitos.bioinf.uni-leipzig.de/result.py?hash=pWBtFmE1 Genetic code 5 vs 9 tRNA S2 4657-4713 (+) tRNA L2 6793-6857 (-)

  7. Snail COI 1-1563 NAD6 1591-1962 NAD5 2019-3593 NAD1 3602-4483 COX2 4610-5245 NAD4L 5385-5648 NAD2 5802-6722 ATP8 6858-6968 NAD3 7190-7564 COX3 8586-9365 12S 9496-10261 ATP6 10392-11021 16S 11272-12204 COB 12345-13613 NAD4 13722-15087 (stop by polyA) Parasite COI 1-1593 16S 1740-2620 12S 2695-3418 COX2 3440-4063 NAD6 4076-4525 NAD5 4852-6417 COX3 7540-8181 COB 8240-9353 NAD4L 9355-9627 NAD4 9630-10874 ATP6 11061-11621 NAD2 11631-12455 NAD1 12774-13586 NAD3 13940-14287

  8. How does this look in Genbank? For instance: https://www.ncbi.nlm.nih.gov/nuccore/KY514384.1

  9. PRACTICE SOFTWARE, SIMILAR EXPERIENCE AS THE ONLINE EXPERIENCE WITH THE WEBPORTAL

  10. A MORE SIMPLE EXAMPLE, All this information Is requiredfor submission Prepare files: >fasta.txt of sequence Names of coworkerscontact info Tentative title publication Collection date, locationprimers, Be aware ofnuclear/mitochondrialgenome, genetic codes,taxonomix ID, methodssoftware

  11. >PE1_16S AGTCGGCAGATGAACTAAATTATTANTATTATTGTCGATATCTTCTGCCCGGTGTTTATAATAAACGGCCGCAGTACCTTGACTGTGTWAAGGTAGCATAATCAATTGGCTATTAATTGTAGTCTAGTATGAATGAAGTAATGAATAGTAACTATAATAAGAAATTTTATTTTAACTTAATGAACTGGTGAAAATACCAGTATTCAGAAAAAAGACGAGAAGACCCTTAGAGTTTTAAATAAAGATTGTTTAAGACTTTGATGTATCATCATCTTAAAGTACATTATACAACACACTTTTTTGTTGGGGCGACAAGAAAGCAATATAACCTTTCTATTTACGCTAAAAGTGGGTATTAGATCTGACGATATTATTATGAATGACTAAACTACCTGAGGGATAACAGCADAATGATAAATATTAGTTTGTGACCTCGATGTTGGACTAGGGACTTGTACACTAACCGTGATAAAAGCTTGTTCTGTTCGAACAATAAAGCC >PE2_16S AGCTTGAAGAATATATTTTAAGTTAATTCTGCCCGGTGCTTTAAGTTAACGGCCGCAGTACCTTGACTGTGCTAAGGTAGCATAATCAATTGGCTATTAATTGTAGTCTAGTATGAAAGAATAAATGATTAGGGGCTATAATAGGGGGTTTAGTTAAAACTTATTTATCAGGTGAAAATACCTGTAATAAGAAAAAAGACGAGAAGACCCTTAGAGTTTAAAAAATTACACTATATCTGATTAGTGGTGTTTTTTATTGGGGCGATAAGAAAACATTATTAAACTTTTCTATCAATGATTGTACAGGCCGAATTTATTATGGATGGCTAAACTACCTTAGGGATAACAGCATAATGATGTATTTTAGTTTGTGACCTCGATGTTGGACTAGGAACTTTAACACTAGCCSGTGGTAAAAGAATGTTCTGTTCGAACAGTTGTTTCC >LE4_16S AGCCCAAAGTTTTTTTTTGGGAAAATTCTGCCCAGCGTAATTTTTTAGCGGGCCGCAGTTCTTTGACTGTGCTAAGGTAGCATAATCAATTGGCCTTTAATTGTAGTCTGGAATGAAAGGACTAATAGGGGTTAGCTGTCTCTATACTATTATTTTGAATTTATTTATTAAGTGAAAATACTTATACAAAGAAAAAAGACGAGAAGACCCTTAGAATTTTAATAAAATATTTAATAATTTTTTTTTGTTGGGGCGACATTGAAACAATTAAACTTTCATTAACAATCAAGACATTTAGGTTTGAAAGAATAAATTACCTTAGGGATAACAGCATAATTAATTATTTAGTTTGTGACCTCGATGTTGGACTAGGAACTAGAAGATTAACCGTCTAAATAGATTGTTCTGTTCGAACAGAAATTCC >A2_16S AGTTCATTGAAATATATTTTGAATTTTTTCCTGCCCAGTGTATAAAAATAAATGGCCGCAGTACCTTGACTGTGCTAAGGTAGCATAATCAATTGGCTTTTAATTGAAGTCTTGGATGAAAGGATTTATGGGAATATTCTGTTTCAAAAGTATTATTTTTAATTTATTTATTAGGTGAAAATACCTTCATAATTATAAAAGACGAGAAGACCCTAAGAATTTTTAGGAAATTTTTTTTCATTATCCTTTTTGTTGGGGCGACAGATAAACAAAAAAACTTAATTTTTAGTATATATCGATTATTTTAGTAAAAATTAAATTACCTTAGGGATAACAGCATAGTTTTAAAAAGTTTGTGACCTCGATGTTGGACTAGGAACTTAATGGCTAGCAGTCAGTAAAGAGTGTTCTGTTCGAACAGTTATTGCC

  12. DEFINITION Physella acuta isolate PS1_17 (or other code) 16S ribosomal RNA gene, partial sequence; mitochondrial. SOURCE mitochondrion Physella acutaORGANISM Physella acuta Eukaryota; Metazoa; Lophotrochozoa; Mollusca; Gastropoda; Heterobranchia; Euthyneura; Panpulmonata; Hygrophila; Planorboidea; Physidae; Physella. JOURNAL Submitted (01-DEC-2017) Biology, University of New Mexico, 1 University of New Mexico, Albuquerque, NM 87131-0001, USA COMMENT ##Assembly-Data-START ## Assembly Method :: Codon Code v. 7.1.1 Sequencing Technology :: Sanger dideoxy sequencing ##Assembly-Data-END## FEATURES Location/Qualifiers source 1..500 /organism="Physella acuta" /organelle="mitochondrion“ /mol_type="genomic DNA" /isolate="PS1_17“ /db_xref="taxon:109671" /country="USA: Albuquerque, NM" /lat_lon="35.216 N 106.6 W" /collection_date="28-Aug-2017" /PCR_primers="fwd_name: 16SAr, fwd_seq: tcgcctgtttatcaaaaacat, rev_name: 16SBr, rev_seq: tccggtctgaactcagatcacgt" rRNA <1..>500 /product="16S ribosomal RNA"

  13. SNAIL AND PARASITE REPORT: “What to write” Summary, why and what, how, results (what snails and parasites locally), implications? WHY and WHAT: Risk for wildlife, livestock, humans from local snails and parasites? Collect, look for parasites, morphology and “4546L” identification. HOW: collect, shed, id morphologically lymnaeid, physid, planorbid, ancylid Parasites: strigeid, echinostome type cercariae Extract DNA from infected snails, quality check: gel-red stained 1% agarose gel, spec. Perform AmpliTaqG PCR 18S, 28S, 16S, COI conserved primers Clone large amplicons TOPOTA PCR2.1, check for inserts w/ EcoRI Sequence BigDye 3.1 direct with PCR primers, cloned fragments vector primers and primer walking direct and by primer walking. Forward and reverse reads edited in Chromas, assembled in Codon Code. One sample genomic DNA -> MBF: Kapa illumina genomic PE (2 x 150nt) sequencing. Bioinformatics (fastqc, trimmomatic, mitobim (bait?), mitos, manual checking Sample identification, alignment (clustal) to similar (BLAST) sequences, using phylogenetics. RESULTS: How many snail types, how many infected, with what Molecular identification: physids/lymnaeids/ancylids are specifically……….., 2 parasites are…. Illumina sequencing yielded complete MT genomes, snail and parasite are………. IMPLICATIONS: NM Shady Lakes has diversity of snails, % prevalence trematode infection. Morphology + PCR = OK for ID. Illumina sequencing more expensive yet easier to obtain informative sequences. Also more information to characterize organisms. Parasites found are potential pathogens for: , presence of particular snails indicates potential for transmission of such parasites. , how, results, what does it mean

More Related