1 / 16

A New Breed The tomatoes in your salad and the dog in your

Interest Grabber. Ch. 13-Genetic Engineering-Section 1. Section 13-1. A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How

lucie
Télécharger la présentation

A New Breed The tomatoes in your salad and the dog in your

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Interest Grabber Ch. 13-Genetic Engineering-Section 1 Section 13-1 A New Breed The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits? On the next slide, work with a partner. Pick two breeds of dogs and give 4 characteristics for each. In the middle green circles, list those characteristics you might see if you bred the two dogs together.

  2. Ch. 13-Genetic Engineering-Section 1 • 13–1 Changing the Living World • A. Selective Breeding • Hybridization-Zorses, wholphins, tigons, and beefaloes. Lepjags, zonkeys, camas, and bonanzees. These are some of the captive-bred mammalian hybrids that exist, and they're joined by a host of hybrid birds, fish, insects, and plants. Thanks to new techniques that allow scientists to isolate and compare DNA, more hybrids are turning up every year, and we're learning that some of them—such as the pizzly, a cross between a polar bear and a grizzly—can occur naturally in the wild.

  3. Ch. 13-Genetic Engineering-Section 1 • 2. Inbreeding • ``There are over 350 known, inherited diseases among purebred dogs, and that's pretty scary,'' said Alison Schaffer, a researcher at the University of California at Davis' Veterinary Genetics Laboratory. • http://www.upei.ca/~cidd/intro.htm • Link to Canine inherited disorders database

  4. Ch. 13-Genetic Engineering-Section 1 • B. Increasing Variation • Scientists and breeders can increase the genetic variation in a population by inducing mutations • 1.Producing New Kinds of Bacteria • a. Oil eating bacteria • 2. Producing New Kinds of Plants • a. Polyploidy • i. Durham semolina wheat • ii. Bananas • iii. Citrus fruits

  5. Hybridization Inbreeding Dissimilar organisms Similar organisms Organism breed B Organism breed A Organism breed A Retains desired characteristics Combines desired characteristics Concept Map Ch. 13-Genetic Engineering-Section 1 Section 13-1 Selective Breeding consists of which crosses which crosses for example for example which which

  6. Ch. 13-Genetic Engineering-Section 2 The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

  7. Ch. 13-Genetic Engineering-Section 2 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

  8. Ch. 13-Genetic Engineering-Section 2 • 13–2 Manipulating DNA • Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules. • A. The Tools of Molecular Biology • DNA Extraction-interactive link • http://learn.genetics.utah.edu/units/biotech/extraction/ • 2. Cutting DNA-restriction enzymes-interactive link • http://www3.interscience.wiley.com:8100/legacy/college/boyer/0471661791/animations/agarose/agarose.htm • 3. Separating DNA-interactive link • http://learn.genetics.utah.edu/units/biotech/gel/

  9. Ch. 13-Genetic Engineering-Section 2 • B. Using the DNA Sequence • If scientists can figure out the sequence then they can use this knowledge to diagnose disease and to change the DNA. • 1. Reading the Sequence interactive link • http://www.pbs.org/wgbh/nova/genome/sequencer.html# • 2. Cutting and Pasting-recombinant DNA video • http://www.present.udel.edu/biotech/rDNA.html • 3. Making Copies-interactive Polymerase Chain reaction: • http://lifesciences.envmed.rochester.edu/movies/PCR_final.swf

  10. Ch. 13-Genetic Engineering-Section 3 Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

  11. Ch. 13-Genetic Engineering-Section 3 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

  12. Ch. 13-Genetic Engineering-Section 3 • 13–3 Cell Transformation • During transformation, a cell takes in DNA from outside the cell. This external DNA becomes a component of the cell's DNA. • A. Transforming Bacteria-interactive link-choose “techniques” • http://www.dnai.org/b/index.html • B. Transforming Plant Cells-interactive link. –scroll down and view “Gene Gun”http://plantandsoil.unl.edu/croptechnology2005/gen/?what=animationList • C. Transforming Animal Cells-same as plants

  13. Ch. 13-Genetic Engineering-Section 4 The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

  14. Ch. 13-Genetic Engineering-Section 4 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?

  15. Ch. 13-Genetic Engineering-Section 4 • 13–4Applications of Genetic Engineering • The universal nature of genetic mechanisms makes it possible to construct organisms that are transgenic, meaning that they contain genes from other species. • A. Transgenic Organisms • 1. Transgenic Microorganisms-insulin, HGH, Blood- clotting factor. • 2. Transgenic Animals-grow faster and leaner • 3.Transgenic Plants-make their own pesticides • B. Cloning-may help save endangered species

More Related