kueng
Uploaded by
25 SLIDES
390 VUES
250LIKES

Exploring Selective Breeding: From Dogs to Tomatoes and Genetic Manipulation

DESCRIPTION

Selective breeding has shaped our world by creating animals and plants with desirable traits. Through generations, humans have developed distinct breeds, like different dog varieties. This process involves predicting the outcomes of crossing individuals with varied characteristics. Additionally, genetic manipulation techniques such as recombinant DNA and gene editing allow scientists to introduce new traits, creating transgenic organisms. Understand how selective breeding and genetic variation impact agriculture and genetics, and delve into the methods that enhance our food supply and preserve biodiversity.

1 / 25

Télécharger la présentation

Exploring Selective Breeding: From Dogs to Tomatoes and Genetic Manipulation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Interest Grabber • A New Breed • The tomatoes in your salad and the dog in your backyard are a result of selective breeding. Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics. How do breeders predict the results of crossing individuals with different traits?

  2. Interest Grabber continued Section 13-1 1. Think of two very different breeds of dogs that are familiar to you. On a sheet of paper, construct a table that has the following three heads: the name of each of the two dog breeds, and “Cross-Breed.”2. The rows of the table should be labeled with characteristics found in both breeds of dogs. Examples might include size, color, type of coat, intelligence, aggression, and so on.3. Fill in the column for each of the two dog breeds. In the column labeled “Cross-Breed,” write in the characteristic you would expect to see in a cross between the two breeds you have selected.

  3. Pekingese Lhasa Apso Peekasso +

  4. Hybridization Inbreeding Dissimilar organisms Similar organisms Organism breed B Organism breed A Organism breed A Retains desired characteristics Combines desired characteristics Concept Map Selective Breeding consists of which crosses which crosses for example for example which which

  5. How can mutations increase the genetic variation in a population? Why would breeders need to induce large numbers of organisms to successfully increase variation?

  6. Haploid: having one set of chromosomes Diploid: having two sets of homologous chromosomes Polyploid: having multiple sets of homologous chromosomes Polyploid?

  7. Interest Grabber The Smallest Scissors in the World Have you ever used your word processor’s Search function? You can specify a sequence of letters, whether it is a sentence, a word, or nonsense, and the program scrolls rapidly through your document, finding every occurrence of that sequence. How might such a function be helpful to a molecular biologist who needs to “search” DNA for the right place to divide it into pieces?

  8. Interest Grabber continued 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find?

  9. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA GTTAAC GTACTAGGTT AACTGTACTATCGTT AACGTAAGCTACGTT AACCTA

  10. Restriction Enzymes Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end Enzyme EcoRI

  11. Restriction Enzymes Recognition sequences DNA sequence Restriction enzyme EcoRI cuts the DNA into fragments. Sticky end

  12. Gel Electrophoresis DNA plus restriction enzyme Power source Longer fragments Shorter fragments Gel Mixture of DNA fragments

  13. Single strand of DNA Fluorescent dye Strand broken after A Power source Strand broken after C Strand broken after G Strand broken after T Gel DNA Sequencing

  14. DNA polymerase adds complementary strand DNA heated to separate strands DNA fragment to be copied PCRcycles 1 DNAcopies 1 3 4 4 8 5 etc. 16 etc. 2 2 PCR

  15. Interest Grabber Sneaking In You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

  16. Interest Grabber continued 1. Computer viruses enter a computer attached to some other file. What are some ways that a file can be added to a computer’s memory? 2. Why would a person download a virus program? 3. If scientists want to get some DNA into a cell, such as a bacterial cell, to what sort of molecule might they attach the DNA?

  17. Recombinant DNA Flanking sequences match host Host Cell DNA Target gene Recombinant DNA replaces target gene Modified Host Cell DNA Knockout Genes

  18. Making Recombinant DNA Section 13-3 Gene for human growth hormone Recombinant DNA Gene for human growth hormone DNA recombination Human Cell Sticky ends DNA insertion Bacterial Cell Bacterial chromosome Bacterial cell for containing gene for human growth hormone Plasmid

  19. Plant Cell Transformation Section 13-3 Agrobacterium tumefaciens Cellular DNA Gene to be transferred Inside plant cell, Agrobacterium inserts part of its DNA into host cell chromosome Recombinant plasmid Plant cell colonies Complete plant is generated from transformed cell Transformed bacteria introduce plasmids into plant cells

  20. Interest Grabber Section 13-4 The Good With the Bad The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

  21. Interest Grabber continued 1. Transgenic animals are often used in research. What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system? 2. Transgenic plants and animals may have increased value as food sources. What might happen to native species if transgenic animals or plants were released into the wild?

  22. transgenicpossessing a gene from another species; used to describe the organisms that have been the subject of genetic engineering (transgenic tomato with tobacco mosaic virus coat protein protected against TMV infection)

  23. Cloning Flowchart Section 13-4 A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.

  24. Cloning of the First Mammal Section 13-4 Donor Nucleus A donor cell is taken from a sheep’s udder. These two cells are fused using an electric shock. Fused Cell Egg Cell An egg cell is taken from an adult female sheep. The nucleus of the egg cell is removed. The fused cell begins dividing normally. Foster Mother Cloned Lamb Embryo The embryo is placed in the uterus of a foster mother. The embryo develops normally into a lamb—Dolly

More Related