lydia
Uploaded by
24 SLIDES
721 VUES
270LIKES

Plant DNA Barcoding: data workflow

DESCRIPTION

Plant DNA Barcoding: data workflow. Aron Fazekas University of Guelph . Plant DNA Barcoding: data workflow. Workflow Outline: raw sequence editing data alignment re-edit the sequence file upload to BOLD quality checks using BOLD / genbank. Sequence editing: primer trimming.

1 / 24

Télécharger la présentation

Plant DNA Barcoding: data workflow

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Plant DNA Barcoding: data workflow Aron Fazekas University of Guelph

  2. Plant DNA Barcoding: data workflow Workflow Outline: raw sequence editing data alignment re-edit the sequence file upload to BOLD quality checks using BOLD / genbank

  3. Sequence editing: primer trimming

  4. Sequence editing: primer trimming 5’ GTTATGCATGAACGTAATGCTC GAGCATTACGT….

  5. Sequence editing: primer trimming

  6. Sequence editing: editing miscalls

  7. Sequence editing: congruence between forward/ reverse reads

  8. Sequence Alignment After editing: need to align the data Kelchner (2000) Ann Missouri Bot Gard rbcL easy to align - most programs work well matK tricky to align – TransAlign seems to do the best job trnH difficult (impossible between genera?) ITS difficult (impossible between genera?) Clustal www.clustal.org TransAlign http://www.biomedcentral.com/1471-2105/6/156 K-Align http://www.ebi.ac.uk/Tools/msa/kalign/

  9. Sequence Alignment Problems to look for after alignment: - primers not trimmed - gaps at the ends - gaps in the middle (protein coding) - translation shows stop codons

  10. - primers not trimmed trnH-psbA Real data submitted for publication - gaps at the ends

  11. rbcL data submitted for publication - gaps in the middle of a coding region

  12. Translate coding regions (rbcL, matK) to ensure there are no stop codons present

  13. Edit both the alignment file and the original sequence file

  14. Can trnH-psbA (or other non-coding sequence) be aligned across diverse species?

  15. Upload to BOLD

  16. After data is edited, aligned: use BOLD to create a tree

  17. Check for misplaced taxa – • remove them from the dataset • Check for singleton species – make a list

  18. BOLD BLAST check

  19. Genbank BLAST check

  20. Genbank BLAST check

  21. Genbank Blast

  22. Acknowledgements Sujeevan Ratnasingham & Bold Team

More Related