1. Plant DNA Barcoding: data workflow Aron Fazekas University of Guelph

2. Plant DNA Barcoding: data workflow Workflow Outline: raw sequence editing data alignment re-edit the sequence file upload to BOLD quality checks using BOLD / genbank

4. Sequence editing: primer trimming

5. Sequence editing: primer trimming 5’ GTTATGCATGAACGTAATGCTC GAGCATTACGT….

6. Sequence editing: primer trimming

7. Sequence editing: editing miscalls

8. Sequence editing: congruence between forward/ reverse reads

9. Sequence Alignment After editing: need to align the data Kelchner (2000) Ann Missouri Bot Gard rbcL easy to align - most programs work well matK tricky to align – TransAlign seems to do the best job trnH difficult (impossible between genera?) ITS difficult (impossible between genera?) Clustal www.clustal.org TransAlign http://www.biomedcentral.com/1471-2105/6/156 K-Align http://www.ebi.ac.uk/Tools/msa/kalign/

10. Sequence Alignment Problems to look for after alignment: - primers not trimmed - gaps at the ends - gaps in the middle (protein coding) - translation shows stop codons

11. - primers not trimmed trnH-psbA Real data submitted for publication - gaps at the ends

12. rbcL data submitted for publication - gaps in the middle of a coding region

13. Translate coding regions (rbcL, matK) to ensure there are no stop codons present

14. Edit both the alignment file and the original sequence file

15. Can trnH-psbA (or other non-coding sequence) be aligned across diverse species?

16. Upload to BOLD

17. After data is edited, aligned: use BOLD to create a tree

19. Check for misplaced taxa – • remove them from the dataset • Check for singleton species – make a list

20. BOLD BLAST check

21. Genbank BLAST check

22. Genbank BLAST check

23. Genbank Blast

24. Acknowledgements Sujeevan Ratnasingham & Bold Team