1 / 29

Definitions

Definitions. tran·scrip·tion (noun): the act of making an exact copy of a document. Example: the very old method for making a copy of a book by hand. trans·la·tion (noun): the rendering of the meaning of something into a different language.

macon
Télécharger la présentation

Definitions

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Definitions • tran·scrip·tion (noun): the act of making an exact copy of a document. • Example: the very old method for making a copy of a book by hand. • trans·la·tion (noun): the rendering of the meaning of something into a different language. • Example: translating Leo Tolstoy’s novel “War and Peace” from Russian (the original) into English.

  2. Translation • The synthesis of a protein polymer from a RNA template • The ribosome translates the chemical language of nucleic acids to amino acids • Provides a control point for regulation of gene expression • Amplification step (can make many protein copies)

  3. Translation • There must be a nucleic acid code for amino acid sequences • 4 different nucleic acid bases, 20 different amino acids • PLUS, need information about where to START and where to STOP translating • Possible CODON sizes: • 1 base 41 = 4 not big enough • 2 bases 42 = 16 not big enough • 3 bases 43 = 64 THIS WOULD WORK • The code could be overlapping or NONOVERLAPPING • Nonoverlapping is less sensitive to mutation

  4. Translation • Codons are nonoverlapping 3 nucleotide units • START = AUG (Methionine) • STOP = UGA, UAG, UAA (does NOT also encode an amino acid) • 61 of 64 codons are left for amino acids • There are only 20 amino acids • The code is “degenerate” with several codons per amino acid • CUN = Leucine • UCN = Serine • CCN = Proline • ACN = Threonine (ACA, ACG, ACC, ACU) (Where N = A, G, C or U) **Note, much of the degeneracy is in the 3rd position of the codon**

  5. Reading the codon table

  6. Transcribe & Translate Co- factor Txn factor RNAp 5’-…TGAGTCACTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’ 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’ 5’-…TATATAAGGC…GATCGCCTCAGGAACCACCATGCTAGCTTGCTGAAATAAA…-3’ 3’-…ATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGATCGAACGACTTTATTT…-5’ TXN 5’-GCCUCAGGAACCACC AUGCUAGCUUGCUGA…AAUAAA…AAAAAAAAAA-3’ TLN: M L A C *(stop) 5’-GCUAAAGAUAGUUAAAUGACAGACUCAGACCCAUAAAAUAAA…AAAAAAAAAA-3’ TLN:

  7. Transfer RNAs (tRNA) • Bridge between nucleic acid and amino acid languages • 73 - 93 nts long • Several modified bases (e.g. pseudouridine, etc) • Complementary regions base pair to form cloverleaf-like structure • Packs further to look like:  • Amino acid attached to 3’-OH via ester linkage • Anticodon loop basepairs with mRNA codon

  8. Transfer RNAs (tRNA) • Degeneracy of code • Lots of tRNA genes • 1 tRNA can recognize > 1 codon • Strict base pair rules for codon position 1 and 2 • “wobble” in position 3 • Non Watson-Crick pairing e.g. G = U pairing

  9. Transfer RNAs (tRNA) • Examples of tRNAs tolerating G = U pairs in codon position 3

  10. Charging tRNAs • The accuracy for protein synthesis is mainly found in the accuracy of attaching the correct amino acid to the correct tRNA • 20 Aminoacyl tRNA synthetase enzymes • 1 enzyme for each amino acid • 1 enzyme can recognize >1 tRNA • Specificity from interactions with acceptor and anticodon arms of tRNA 2 step reaction ATP + AA --> AA-AMP + PPi AA-AMP + tRNA --> AA-tRNA + AMP tRNA synthetase enzymes proofread: Can hydrolyze wrong amino acid from tRNA

  11. Charging tRNAs 2 step reaction ATP + AA --> AA-AMP + PPi AA-AMP + tRNA --> AA-tRNA + AMP tRNA synthetase enzymes proofread: Can hydrolyze wrong amino acid from tRNA

  12. The ribosome • Large RNA-Protein complex • Large ribosomal subunit (60S) • Small ribosomal subunit (40S) • Steps in translation INITIATION • Bind mRNA, find start ELONGATION • Find next amino acid, add it TERMINATION • Recognize stop, and release

  13. Translation mechanism: bacteria • INITIATION • Small subunit binds “Shine-Dalgarno” sequence in mRNA 5’-AGGAGG-3’ DNA: 5’-…TATAAT n n n n A n n n n AGGAGG n n n n n ATG…-3’ -10 +1 mRNA: 5’-A n n n n AGGAGG n n n n n AUG…-3’

  14. Translation mechanism: bacteria • INITIATION • Small subunit binds Shine-Dalgarno sequence in mRNA to locate AUG • INITIATION FACTORS • IF1, IF2, IF3 • IF2 binds GTP

  15. Translation mechanism: bacteria • INITIATION • Small subunit binds Shine-Dalgarno sequence in mRNA to locate AUG • INITIATION FACTORS • IF1, IF2, IF3 • IF2 binds GTP • IF2 binds initiating tRNA-Met

  16. Translation mechanism: bacteria • INITIATION • Small subunit binds Shine-Dalgarno sequence in mRNA to locate AUG • INITIATION FACTORS • IF1, IF2, IF3 • IF2 binds GTP • IF2 binds initiating Met-tRNA • Recruit large subunit, release IF1, IF3 • If codon-anticodon interaction is correct, IF2 hydrolyzes GTP and leaves

  17. Translation mechanism: eukaryotes • INITIATION • SCANS 5’ --> 3’ for Start • eIF4 and other factors involved in sensing additional features of mRNA • 5’-CAP structure • 3’-end polyA tail • eIF1, 2, 3 + Small subunit complex binds 5’-CAP region • Scan 5’--> 3’ for a different consensus sequence 5’-CCACCAUG-3’

  18. Translation mechanism: bacteria • ELONGATION • After large subunit bound, 3 sites are present in ribosome • Aminoacyl (A) site • Peptidyl (P) site • Exit (E) site • tRNA-MET in P site • EF-Tu + GTP + Phe-tRNA bind in A site • If codon-anticodon interaction is proper, hydrolyze GTP --> GDP, release EF-Tu

  19. Translation mechanism: bacteria • ELONGATION • If codon-anticodon interaction is proper, hydrolyze GTP --> GDP, release EF-Tu • Peptidyl transferase enzyme catalyzes bond formation • Ribozyme (large subunit RNA) • Met is now attached at the “A” site: Met-Phe-tRNA

  20. Translation mechanism: bacteria • ELONGATION • Whole ribosome must be translocated 3 nts downstream on mRNA • EF-G hydrolyzes GTP for translocation reaction • tRNA in P site is now in E • Met-Phe-tRNA is now in P • Repeat ELONGATION cycle until a stop codon is reached

  21. Translation mechanism: bacteria • ELONGATION • Repeat ELONGATION cycle until a stop codon is reached • EF-Tu + GTP + Ser-tRNA --> EF-Tu + GDP (note exit of tRNA from E site) • Peptidyl transferase activity would yield Met-Phe-Ser-tRNA in A site • And so on…

  22. Translation mechanism: bacteria • TERMINATION • Stop codons are not recognized by any wildtype tRNAs • Three Release Factor proteins • RF1 • RF2 • RF3 • Enter A site and trigger hydrolysis of Met-Phe-Ser from tRNA • Large and small subunits dissociate from mRNA template U A A

  23. Polyribosomes • mRNAs can be translated by multiple ribosomes at same time • Amplification step in gene expression

  24. Coupled TXN & TLN: bacteria • A gene can be transcribed and translation of it can start before TXN is finished • Could this happen in eukaryotes?

  25. Frameshift mutations 5’-GCCUCAGGAACCACC AUGCUAGCUUGCUGAAAUAAAAAAAAAAA-3’ TLN: M L A C *(stop) • Consider the following mRNA sequence • Frameshift mutations insert or delete one or more bases into an Open Reading Frame (ORF) • Insert one base • Delete one base 5’-GCCUCAGGAACCACC AUGCUCAGCUUGCUGAAA UAA AAAAAAAAA-3’ TLN: M L S L L K *(stop) 5’-GCCUCAGGAACCACC AUG UAG CUUGCUGAAAUAAAAAAAAAAA-3’ TLN: M *(stop)

  26. Nonsense mutations & nonsense mediated decay 5’-GCCUCAGGAACCACC AUGCUAUGGUGCUGAAAUAAAAAAAAAAA-3’ TLN: M L W C *(stop) • Consider the following mRNA sequence • Nonsense mutations change an amino acid codon to a stop codon • If this mutation is in any exon other than the last one, • Nonsense mediated decay (NMD) will block translation of it 5’-GCCUCAGGAACCACC AUGCUAUGAUGCUGAAAUAAAAAAAAAAA-3’ TLN: M L *(stop)

  27. Nonsense mutations & nonsense mediated decay • Exon-Junction Complex (EJC) proteins are deposited on transcripts ~20 nts upstream of new Exon-Exon junctions • Ribosome knocks them off during TLN • If ribosome doesn’t knock them off, transcript is destroyed • Wildtype mRNA: • Nonsense mutation mRNA: • EJC that is not removed generates a signal targeting mRNA for destruction EJC EJC EJC X EJC EJC EJC X X

More Related