380 likes | 422 Vues
Explore the basics of cloning procedures, stem cell research controversies, and genetic engineering advancements in this informative guide. Understand the history of cloning, therapeutic potential of stem cells, and the process of genetic engineering. Learn about induced pluripotent stem cells (IPSCs) and the Human Genome Project. Discover the benefits and ethical dilemmas associated with these cutting-edge technologies.
E N D
What is Cloning? • Making an exact genetic copy of a cell, organ or an organism • This process uses SOMATIC CELLS (non-sex cells) instead of sex cells because somatic cells contain a complete set of chromosomes (46).
Basics of the Cloning ProcedureSomatic Cell Nuclear Transfer This happens in vitro (outside the body). The nucleus of a somatic cell is placed inside an egg cell that has had its nucleus removed. Electricity sparks cell division of the egg cell and an embryo is formed.
Basics of the Cloning Procedure An embryo is the form of the organism in its early stages. It is a group of undifferentiated cells. The embryo is placed in the uterus of the egg donor or surrogate mother. A surrogate mother is a female who carries the baby for another female.
HISTORY OF CLONING • 1953 frog • 1996 sheep • 1998 cow • 2001 rabbit • 2002 rat • 2002 cat • 2003 horse • 2005 dog
Cloning does not always produce expected results. It is also expensive and inefficient! • CC the cat cost $50,000 to create. Her genetics were the same as her clone, however she did not appear identical! Why? • Horse- 841 attempts = .12% efficiency • Sheep- 277 attempts = .36% efficiency
Rainbow- Parent Clone CC- Copy Cat
Cloning Pros/Cons Pros Cons Does not help to improve the genetic diversity of a species. Could create a black market for transplant organs-Create clones to harvest organs! Expensive and inefficient! • Can clone organs for transplant patients. • Can help infertile couples have offspring genetically linked to one of the parents. • Can increase populations of endangered species. • Can bring back a deceased pet. • Can replicate living things with desirable traits- like trees that grow quickly.
STEM CELL RESEARCH • What is a stem cell? • A cell that is not yet differentiated into a specific type. • What’s so special about embryonic stem cells? • They are Pluripotent • can become any of the 220 different cell types
Why is the use of embryonic stem cells so controversial? • Removing a stem cell from an embryo for experimentation destroys the embryo. • Is this murder? • When does life begin? • Read and discuss “Embryos R Us Case Study”
Therapeutic potential Turn the stem cells into: • Pancreas cells to produce insulin to relieve diabetes • Dopamine producing cells in the brain to relieve Parkinson’s disease • New limbs and failing organs
Is it controversial to experiment on all stem cells? In addition to embryonic stem cells, there are adult stem cells. Adult stem cells are found in many organs and tissues, including brain, bone marrow, blood and skin. These stem cells are multipotent which means they can only become a certain type of cell(s) . Their purpose is to maintain and repair the tissue in which they are found.
Is it controversial to experiment on all stem cells? Experimenting with adult stem cells is not controversial because it does not harm the adult if the cells are removed from the body. There has been some exciting recent research that has demonstrated the ability to turn adult stem cells into embryo-like stem cells. These are called “induced pluripotent stem cells” (IPSCs).
Genetic Engineering • gene- DNA sequence that codes for a protein. AATCGTAACCGGTTA • genome -all the possible bases in a species or individual • Human Genome Project (1990-2003)- All of the base pairs in the human genome have been sequenced (locations of genes on the 23 chromosomes have been determined). The human genome has approximately 20, 500 genes.
What is Genetic Engineering? • The modification of the DNA in an organism or the exchange of DNA between organisms. • Why would we want to do this? • Genetic engineering can happen between different species because the DNA code is universal. All living things have ACGT nucleotides and the same amino acid coding scheme. • AUG codes for methionine in all living things!
Steps to Genetic Engineering • 1. A gene of interest is removed from a genome. • 2. The gene is attached to a vector (transporter) and delivered into a host cell • 3. The host cell is put into a nutrient medium and allowed to divide many times to create many copies of the gene. • 4. The host cell is inserted into the organism.
How is a gene removed from a genome? • Restriction enzymes- recognize a specific DNA sequence and cut the DNA wherever that sequence exists. ATCGGATGAATTCTACCGATTAAG TAGCCATCTTAAGATGGCTAATTC
How is the gene of interest separated from other genes? Gel electrophoresis
Gel Elecrophoresis DNA samples are placed in a porous gel which is connected to an electric current. The current moves the DNA pieces and separates them based on their size. The smallest pieces move the fastest and end up at the bottom. We can use this technique to isolate genes, determine genetic relationships (paternity), determine evolutionary relationships, and solve crimes.
What is a common vector used in genetic engineering? Plasmids are circular DNA molecules found in bacteria that are often used for genetic engineering. The plasmid is cut with the same restriction enzyme used to cut out the gene of interest. Once the plasmid has the new gene, it is called recombinant DNA.
Gene Therapy • Humans can be genetically engineered. • Normal genes can be inserted into cells containing defective genes in order to correct genetic disorders.
Paternity Testing If there is uncertainty about a child’s biological father, DNA samples from the possible fathers can be compared with the DNA of the child and mother. All DNA samples are treated with the same restriction enzyme and are run on a gel by electrophoresis. A child’s DNA pieces are a combination of pieces from the mother and father (each DNA band must match a band from one parent).
Who is the father? • Circle the smallest DNA fragment(s). • Box the largest DNA fragment(s).
A=father B=mother Are C and D both biological children of A and B?
Genetics Technology Bingo 13. Gene therapy 14. Genome 15. Gene 16. Recombinant DNA 17. In vitro 18. Somatic cell 19. Somatic cell nuclear transfer 20. Vector 21. Uterus 22. X-inactivation 23. Embryonic stem cell 24. Pluripotent 1. Cloning 2. Induced pluripotent stem cells 3. Embryo 4. Multipotent 5. Surrogate 6. Technology 7. Gel electrophoresis 8. Plasmid 9. Adult stem cell 10. Genetic engineering 11. Electricity 12. Restriction enzyme
Biotechnology Test Review Questions: • Easy • Small, circular piece of bacterial DNA is called a ____. • Give two examples of vectors: • The entire collection of genes within human cells is called the _______________. • Difference between technology and biotechnology? • Function of restriction enzymes? • HGP stands for? How many base pairs in HG? How many proteins? • Difference between surrogate and biological mother? • A _____________ is caused by a defective or mutant gene. • Define gene. • The first cell created by sexual reproduction is called a
Medium • 1. Inserting unrelated pieces of DNA together will result in ____________________. • 2. IVF stands for? What is a synonym used for IVF? • 3. What does transgenic mean? • 4. Idenical twins are considered to be genetic ___________. • 5. How does IVF work? What does the female have to do? What does the male have to do? • 6. Why does IVF sometimes result in twins, triplets, or quads? • 7. Difference between fraternal vs. identical twins? • 8. How does Gel Electrophoresis separate DNA fragments? • 9. What is an example of a genetic disease? • 10. What kind of ethical questions arise from IVF?
Difficult • What is the difference between gene therapy and genetic engineering? • Difference between a hybrid and chimera? • Steps of genetic engineering? • The Hind R1 restriction enzyme is used to slice DNA at the GAATTC between the G and A. Illustrate how this enzyme would precisely cut the fragment: • ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTAGCTACATCTA • TAATCTAGAGGGATCTTAAGTTCGACCATCGATCGATGTAGAT • What research can be done using gel electrophoresis?