Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Additional file 3 PowerPoint Presentation
Download Presentation
Additional file 3

Additional file 3

110 Vues Download Presentation
Télécharger la présentation

Additional file 3

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Additional file 3 >HWI-EAS344:7:70:153:1969#0/1 Length = 75  Score = 137 bits (69), Expect = 4e-29 Identities = 69/69 (100%) Strand = Plus / Plus Query: 4863 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 4922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 66 >HWI-EAS344:7:17:1346:939#0/1 Length = 75  Score = 137 bits (69), Expect = 4e-29 Identities = 69/69 (100%) Strand = Plus / Plus Query: 4863 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 4922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 66