High-Precision Sequence Alignment with Perfect Identity Matches

DESCRIPTION

This entry presents a detailed analysis of two high-precision sequence alignments with identical nucleotide sequences. Both sequences exhibit 100% identity across 69 bases, highlighting their evolutionary conservation. The alignment scores (137 bits) indicate a significant strength, with extremely low expected values (4e-29), suggesting that these sequences share an evolutionary relationship. The alignment demonstrates perfect match conditions, indicating a reliable data set for further studies in molecular biology and genomics.

Download

1 / 1

Apr 29, 2026

Download Presentation

Télécharger la présentation

High-Precision Sequence Alignment with Perfect Identity Matches

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Additional file 3 >HWI-EAS344:7:70:153:1969#0/1 Length = 75 Score = 137 bits (69), Expect = 4e-29 Identities = 69/69 (100%) Strand = Plus / Plus Query: 4863 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 4922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 66 >HWI-EAS344:7:17:1346:939#0/1 Length = 75 Score = 137 bits (69), Expect = 4e-29 Identities = 69/69 (100%) Strand = Plus / Plus Query: 4863 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 4922 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 7 atattatgttatcgcatgtatttcggaaaaataacatgttacaaaggacatttacgtaat 66