1 / 52

From Gene to Protein: Understanding Protein Synthesis

Learn how genes are read, how cells make proteins from DNA, and the importance of proteins in creating phenotypes. Explore the inheritance of metabolic diseases and the one gene-one enzyme hypothesis.

mariagray
Télécharger la présentation

From Gene to Protein: Understanding Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From Gene to Protein How Genes Work

  2. Making proteins • Organelles • nucleus • ribosomes • endoplasmic reticulum (ER) • Golgi apparatus • vesicles small ribosomal subunit nuclear pore mRNA large ribosomal subunit cytoplasm

  3. Nucleus & Nucleolus

  4. Nucleolus large subunit small subunit ribosome • Function • ribosome production • build ribosome subunits from rRNA & proteins • exit through nuclear pores to cytoplasm & combine to form functional ribosomes rRNA & proteins nucleolus

  5. Ribosomes large subunit small subunit 0.08m Ribosomes Rough ER Smooth ER • Function • protein production • Structure • rRNA & protein • 2 subunits combine

  6. Types of Ribosomes • Freeribosomes • suspended in cytosol • synthesize proteins that function in cytosol • Bound ribosomes • attached to endoplasmic reticulum • synthesize proteins for export or for membranes membrane proteins

  7. TO: TO: TO: TO: endoplasmicreticulum nucleus proteinon its way! DNA RNA vesicle vesicle ribosomes TO: protein finishedprotein Golgi apparatus Making Proteins

  8. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTATACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTA What happens in the cellwhen a gene is read? Where are the genes? Where does a gene start?Where does the gene end? How do cells make proteinsfrom DNA? How is one gene read and another one not? How do proteinscreate phenotype?

  9. Metabolism taught us about genes disease disease disease disease A B C D E • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism Am I just the sum of my proteins? metabolic pathway     enzyme 1 enzyme 2 enzyme 3 enzyme 4

  10. PKUphenylketonuria albinism cretinism tyrosinosis alkaptonuria ingested protein digestion phenylalanine phenylalanine hydroxylase melanin tyrosine thyroxine transaminase hydroxyphenylpyruvicacid hydroxyphenylpyruvic acidoxidase homogentisicacid homogentisic acidoxidase maleylacetoaceticacid CO2 & H2O

  11. 1 gene – 1 enzyme hypothesis • Beadle & Tatum • Compared mutants of bread mold, Neurospora fungus • created mutations by X-ray treatments • X-rays break DNA • damage a gene • wild type grows on minimal media • sugars + required nutrients allows fungus to synthesize essential amino acids • mutants require added amino acids • each type of mutant lacks a certain enzyme needed to produce a certain amino acid • non-functional enzyme from damaged gene

  12. X rays or ultraviolet light Wild-type Neurospora asexual spores Minimal medium Growth on complete medium spores Select one of the spores Grow on complete medium Test on minimal medium to confirm presence of mutation Minimal media supplemented only with… Choline Pyridoxine Riboflavin Minimal control Nucleic acid Arginine Niacin Inositol Folic acid p-Amino benzoic acid Thiamine Beadle & Tatum create mutations positive control negative control mutation identified experimentals amino acidsupplements

  13. One gene / one enzyme hypothesis • Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E arg-H arg-G arg-F encoded enzyme enzyme E enzyme F enzyme G enzyme H glutamate ornithine citruline arginine argino- succinate gene thatwas damaged substrate in biochemical pathway

  14. Beadle & Tatum 1941 | 1958 one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

  15. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

  16. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

  17. fromDNA nucleic acid languagetoRNA nucleic acid language Transcription

  18. Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  19. Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

  20. Transcription in Prokaryotes • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter • Starting point • where to start reading • start of gene • Template strand • which strand to read • Direction on DNA • always read DNA 35 • build RNA 53

  21. Transcription in Prokaryotes • Promoter sequences enzymesubunit RNA polymerase read DNA 35 bacterial DNA Promoter TTGACA TATAAT –35 sequence –10 sequence RNA polymerase molecules bound to bacterial DNA RNA polymerase strong vs. weak promoters

  22. Transcription in Prokaryotes • Elongation • RNA polymerase copies DNA as it unwinds • ~20 base pairs at a time • 300-500 bases in gene • builds RNA 53 Simple proofreading • 1 error/105 bases • make many mRNAs • mRNA has short life • not worth editing! reads DNA 35

  23. Transcription in Prokaryotes • Termination • RNA polymerase stops at termination sequence RNA GC hairpin turn

  24. Transcription in Eukaryotes Transcription RNA Processing Psssst…DNA can’tleave nucleus! Translation Protein

  25. Prokaryote vs. Eukaryote genes Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence • Prokaryotes • DNA in cytoplasm • circular chromosome • naked DNA • no introns intronscome out! eukaryotic DNA

  26. Transcription in Eukaryotes • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

  27. Transcription in Eukaryotes • Initiation complex • transcription factors bind to promoter region upstream of gene • suite of proteins which bind to DNA • turn on or off transcription • TATA box binding site • recognition site for transcription factors • transcription factors trigger the binding of RNA polymerase to DNA

  28. Post-transcriptional processing intron = noncoding (inbetween) sequence exon = coding (expressed) sequence • Primary transcript (pre-mRNA) • eukaryotic mRNA needs work after transcription • mRNA processing (making mature mRNA) • mRNA splicing = edit out introns • protect mRNA from enzymes in cytoplasm • add 5 cap • add polyA tail 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  29. Splicing must be accurate • No room for mistakes! • splicing must be exactly accurate • a single base added or lost throws off the reading frame AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  30. Splicing enzymes snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' Whoa! I think we just brokea biological “rule”! • snRNPs • small nuclear RNA • proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste No, not smurfs! “snurps”

  31. Ribozyme 1982 | 1989 • RNA as ribozyme • some mRNA can even splice itself • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado

  32. fromnucleic acid languagetoamino acid language Translation

  33. Translation • Codons • blocks of 3 nucleotides decoded into the sequence of amino acids

  34. Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst…no nucleus! protein Cell membrane Cell wall

  35. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  36. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing

  37. Translation in Eukaryotes

  38. From gene to protein aa aa aa aa aa aa aa aa ribosome transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

  39. How does mRNA code for proteins? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA ? MetArgValAsnAlaCysAla protein 4 ATCG 4 AUCG 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)?

  40. mRNA codes for proteins in triplets TACGCACATTTACGTACGCGG DNA codon AUGCGUGUAAAUGCAUGCGCC AUGCGUGUAAAUGCAUGCGCC mRNA mRNA ? MetArgValAsnAlaCysAla protein

  41. Cracking the code 1960 | 1968 Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine (phe)

  42. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  43. How are the codons matched to amino acids? UAC GCA CAU Met Arg Val 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA aminoacid anti-codon

  44. From gene to protein aa aa aa aa aa aa aa aa ribosome transcription translation DNA mRNA protein nucleus cytoplasm

  45. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  46. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • energy stored in tRNA-amino acid bond • unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  47. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  48. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  49. Building a polypeptide 3 2 1 • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  50. Protein targeting Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… • Signal peptide • address label start of a secretory pathway

More Related