marin
Uploaded by
25 SLIDES
376 VUES
250LIKES

Base Mutations on Protein Function and Phenotypes

DESCRIPTION

This text explores how mutations in DNA affect protein synthesis and can alter phenotypes. Proteins, composed of amino acids, are crucial for various cellular functions, including structural support, hormonal signaling, and catalyzing biochemical reactions. Mutations can occur during DNA replication or meiosis, leading to potential changes in protein function and expression, which can cause traits such as sickle cell anemia or achondroplasia. The impact of environmental factors and the body's proofreading mechanisms in maintaining genetic integrity are also discussed.

1 / 25

Download Presentation
Télécharger la présentation

Base Mutations on Protein Function and Phenotypes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Base Mutations on Protein Function and Phenotypes

  2. Polypeptides made up of amino acids • Proteins are polypeptides, numerous amino acids **Notice the “R” group. It’s a group of molecules that determines the amino acid. **Peptide Bond between amino acids First Recall Proteins------

  3. The amino acid sequence determines the protein!! • Shape-specific • Example - The sequence for a specific enzyme will be totally different from that of a hormone! Human Growth Hormone Amylase Enzyme Amino Acid Sequence - Polypeptide

  4. Basic Types of Proteins

  5. Forms part of cell materials • Provides support • fibrous and stringy and provide support. Examples: Keratins strengthen protective coverings such as hair, quills, feathers, horns, and beaks. include keratin • Collagen, and elastin are examples. Collagens and elastin provide support for connective tissue such as tendons and ligaments. Structural Proteins

  6. Hormones – Chemical Signals released by a cell or a gland in one part of the body that sends out messages that affect cells in other parts of the organism • Growth and development • Metabolism - how your body gets energy from the foods you eat • Sexual function • Reproduction • Mood • Enzymes – catalyze chemical reactions. • Example – Amylase is the enzyme that breaks starches in your mouth. Speeds up the rate of digestion. • Nearly all biochemical reactions require them! Functional Proteins

  7. ** Newly synthesized DNA is EXACTLY the same as the parent DNA……or is it??

  8. Remember that DNA is replicated during the S phase of Interphase of the cell cycle and during Meiosis (the formation of gametes) • Mutations may or may not change the function of a protein • May change phenotype or how a gene is expressed • Example: brown hair is a phenotype, sickle cell anemia is a phenotype, dwarfism is a phenotype Mistakes Can Occur!!

  9. ***Errors usually occur during DNA replication and transcription by external agents called mutagens (chemicals, radiation, X-rays etc.) ***Some occur randomly and some phenotypes are selected for in nature ***Although mutations can cause problems, if it weren’t for mutations, we wouldn’t have new genes such as those for green eyes Mutations

  10. Enzymes proofread as bases are paired during replication and replace those wrongly paired • Other enzymes police the replication process • But………… “Fixing” Errors

  11. May be random or spontaneous. • When genes have an error in their DNA code, they may not work properly, and are said to be "altered" or mutated. • DNA damage from environmental agents such as radiation (sunlight), nuclear radiation, some viruses, some chemicals, genetics, inflammation, infection • Mistakes that occur when a cell copies its DNA in preparation for cell division. • Can occur during meiosis (making of sperm, and egg) • Changes mRNA codons Mutations Change a DNA Sequence and May Affect a Gene

  12. Mismatched Base Pair Can Occur – Usually Random

  13. Spontaneous Mutations Environmental agents such as nuclear radiation can damage DNA by breaking bonds between nucleotides on either side of the DNA molecule can occur

  14. Mutated Cells • Some mutated cells will be defeated by the body's immune system • others may undergo apoptosis, or “cell suicide”. • occasionally a cell with mutations slips through proofreading safeguards. • When mutations accumulate, the genetic material is so scrambled that the cell no longer acts like a normal, healthy cell. • Tumors, mass of cells that have no purpose, may form

  15. Not malignant tumor (cancerous) • Does not invade nearby tissue or spread to other parts of the body the way cancer can. • But benign tumors can be serious if they press on vital structures such as blood vessels or nerves. • Some, such as colon polyps, can become cancerous Benign Tumors (non-cancerous)

  16. Abnormal cells grow uncontrolled • Invades surrounding tissues • Usually capable of producing metastases (spread to other organs) • May recur after attempted removal • May cause death of the host unless adequately treated Cancerous Tumor (malignant)

  17. **Mutations can occur during meiosis, the making of sperm or egg and can be passed along to offspring **Example: Achonroplasia is a type of dwarfism that can come from a mutation during sperm formation **The mutation may produce a new trait (good OR bad) . Mutations and Reproduction

  18. ** Point mutations, base substitution, affects a single base **Frameshift – Addition or deletion of a base – Affects entire protein Types of Base Mutations

  19. Base Pair Substitution – AKA Point Mutation

  20. Affects a single base and change the codon • May or may not affect the amino acid • Sometimes if the third base of the codon changes, the amino acid may stay the same! • UCU • UCC • UCA • UCG ALL code for Ser Point Mutations

  21. TACCAGGATTAACATGGAAGTGTAATC DNA AUGGUCCUAAUUGUACCUUCACAUUAG mRNA Met Met Val Val Leu Leu Ile Ile Val Pro Pro Ser Ser His His (STOP) (STOP) Leu Base Substitution MAY or MAY NOT Change the Protein What if the C was substituted with an A ????? TACCAGGATTAA AATGGAAGTGTAATC DNA AUGGUCCUAAUU UUACCUUCACAUUAG mRNA REMEMBER if the 3rd base is changed, it may not change the protein!

  22. Sickle Cell Anemia – red blood cells have a protein on their surgface called hemoglobin that carry oxygen. Patients with this affliction have misshaped (sickle-shaped) red blood cells and cannot carry enough oxygen **Notice the DNA sequence below.. A is substituted for a T Base Substitution Example

  23. Insertion (addition) or deletion of a base shift the frame of bases left or right, changing the amino acids affecting the whole protein. It won’t function properly Frameshift Mutation

  24. Phe Met Met Val Val Asp Leu Leu Ile Ile Val Thr Pro Ser His (STOP) Thr Leu Extra Base Frame-Shift Addition Example: Addition of a T beside of the C... shifts the entire protein over to the right– changes ENTIRE PROTEIN – There is NO STOP CODON!! DNA DNA mRNA mRNA TACCAGGATTAACATGGAAGTGTAATC AUGGUCCUAAUUGUACCUUCACAUUAG TACCAGGATTAA CTATGGAAGTGTAATC… GAUACCUUCACAUUAG… AUG GUC CUA AUU

  25. Ile His Met Met Val Val Leu Thr Leu Ile Ile Val Pro Leu Ser His (STOP) Ser or Arg Frameshift Deletion Example: Deletion of the C... shifts the entire protein over to the Left– changes ENTIRE PROTEIN – There is NO STOP CODON!! DNA DNA mRNA mRNA TACCAGGATTAACATGGAAGTGTAATC AUGGUCCUAAUUGUACCUUCACAUUAG TACCAGGATTAA ATGGAAGTGTAATC… UACCUUCACAUUAG… AUG GUC CUA AUU

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer